Details for gene: CAV1


The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.


Symbol
CAV1
Name
caveolin 1
Entrez ID
857
Ensembl ID
ENSG00000105974    (more details)
KEGG ID
hsa:857    (more details)
OMIM ID
601047
Uniprot ID
Q03135  
GO ID
hsa:857    (more details)
Chromosome
7
Strand
1
Start
116524994
End
116561179
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-942-5p (RPM: 2.297) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-5004-3p (RPM: 0.0402) / hsa-miR-582-3p (RPM: 12.5308) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-5193 (RPM: 0.0094) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-548k (RPM: 8.758) / hsa-miR-4673 (RPM: 0.0558) / hsa-miR-4722-5p (RPM: 0.0332) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-3140-3p (RPM: 0.0794) / hsa-miR-1911-3p (RPM: 1.2982) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-136-5p (RPM: 38.7962) / hsa-miR-4796-3p (RPM: 0.125) / hsa-miR-548ah-5p (RPM: 1.0636) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-548l (RPM: 0.078) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-92a-1-5p (RPM: 8.113) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-873-5p (RPM: 18.2502) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-548y (RPM: 0.046) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-659-3p (RPM: 0.0056) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-485-3p (RPM: 10.0736) / hsa-miR-4517 (RPM: 0.0368) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-660-3p (RPM: 0.609) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-556-5p (RPM: 0.386) / hsa-miR-1238-3p (RPM: 0.0018) / hsa-miR-625-5p (RPM: 10.5462) / hsa-miR-1261 (RPM: 0.0038) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-4791 (RPM: 0.0674) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-4463 (RPM: 0.0074) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-16-2-3p (RPM: 15.7658) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-584-3p (RPM: 0.2294) / hsa-miR-3609 (RPM: 6.639) / hsa-miR-24-2-5p (RPM: 18.574) / hsa-miR-520g-3p (RPM: 0.0022) / hsa-miR-520h (RPM: 0.0012) / hsa-miR-374b-3p (RPM: 5.4276) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-652-3p (RPM: 178.199) / hsa-miR-6749-3p (RPM: 0.0746) / hsa-miR-627-3p (RPM: 0.3504) / hsa-miR-670-3p (RPM: 1.3964) / hsa-miR-6792-3p (RPM: 0.0262) / hsa-miR-6753-5p (RPM: 0.0068) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Endocytosis / Focal adhesion / Proteoglycans in cancer / Prion diseases / Viral myocarditis / Bacterial invasion of epithelial cells / Generic Transcription Pathway / RNA Polymerase II Transcription / Gene expression (Transcription) / Metabolism / Metabolism of lipids / Hemostasis / Signal Transduction / Signaling by Receptor Tyrosine Kinases / Signaling by VEGF / VEGFA-VEGFR2 Pathway / FOXO-mediated transcription / Signaling by Nuclear Receptors / Triglyceride catabolism / Signaling by WNT / TCF dependent signaling in response to WNT / Metabolism of nitric oxide: NOS3 activation and regulation / Cell surface interactions at the vascular wall / eNOS activation / NOSTRIN mediated eNOS trafficking / Basigin interactions / Disassembly of the destruction complex and recruitment of AXIN to the membrane / VEGFR2 mediated vascular permeability / ESR-mediated signaling / Triglyceride metabolism / Extra-nuclear estrogen signaling / FOXO-mediated transcription of cell cycle genes / RAC1 GTPase cycle / RAC2 GTPase cycle / RHOG GTPase cycle / RAC3 GTPase cycle / RND3 GTPase cycle / RND2 GTPase cycle / RND1 GTPase cycle / CDC42 GTPase cycle / RHOA GTPase cycle / RHOB GTPase cycle / RHOC GTPase cycle / RHOD GTPase cycle / RHOQ GTPase cycle / RHOH GTPase cycle / RHOJ GTPase cycle / RHOF GTPase cycle / Fluid shear stress and atherosclerosis /
Sequence
ATGTCTGGGGGCAAATACGTAGACTCGGAGGGACATCTCTACACCGTTCCCATCCGGGAACAGGGCAACATCTACAAGCCCAACAACAAGGCCATGGCAGACGAGCTGAGCGAGAAGCAAGTGTACGACGCGCACACCAAGGAGATCGACCTGGTCAACCGCGACCCTAAACACCTCAACGATGACGTGGTCAAGATTGACTTTGAAGATGTGATTGCAGAACCAGAAGGGACACACAGTTTTGACGGCATTTGGAAGGCCAGCTTCACCACCTTCACTGTGACGAAATACTGGTTTTACCGCTTGCTGTCTGCCCTCTTTGGCATCCCGATGGCACTCATCTGGGGCATTTACTTCGCCATTCTCTCTTTCCTGCACATCTGGGCAGTTGTACCATGCATTAAGAGCTTCCTGATTGAGATTCAGTGCATCAGCCGTGTCTATTCCATCTACGTCCACACCGTCTGTGACCCACTCTTTGAAGCTGTTGGGAAAATATTCAGCAATGTCCGCATCAACTTGCAGAAAGAAATATAA

Back to List