Details for gene: CAV2


The protein encoded by this gene is a major component of the inner surface of caveolae, small invaginations of the plasma membrane, and is involved in essential cellular functions, including signal transduction, lipid metabolism, cellular growth control and apoptosis. This protein may function as a tumor suppressor. This gene and related family member (CAV1) are located next to each other on chromosome 7, and express colocalizing proteins that form a stable hetero-oligomeric complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Additional isoforms resulting from the use of alternate in-frame translation initiation codons have also been described, and shown to have preferential localization in the cell (PMID:11238462).


Symbol
CAV2
Name
caveolin 2
Entrez ID
858
Ensembl ID
ENSG00000105971    (more details)
KEGG ID
hsa:858    (more details)
OMIM ID
601048
Uniprot ID
P51636  
GO ID
hsa:858    (more details)
Chromosome
7
Strand
1
Start
116287380
End
116508541
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-570-3p (RPM: 0.1902) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-221-3p (RPM: 758.7978) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-302a-5p (RPM: 0.1518) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-222-5p (RPM: 13.2904) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-365a-5p (RPM: 0.6394) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-365b-5p (RPM: 1.3016) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-3199 (RPM: 0.1412) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-6747-3p (RPM: 0.3694) / hsa-miR-6764-5p (RPM: 0.111) / hsa-miR-6727-3p (RPM: 0.0068) / hsa-miR-6840-3p (RPM: 0.0218) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Endocytosis / Focal adhesion / Proteoglycans in cancer / Prion diseases / Bacterial invasion of epithelial cells / Signal Transduction / Signaling by Nuclear Receptors / ESR-mediated signaling / Extra-nuclear estrogen signaling / Fluid shear stress and atherosclerosis /
Sequence
ATGGGGCTGGAGACGGAGAAGGCGGACGTACAGCTCTTCATGGACGACGACTCCTACAGCCACCACAGCGGCCTCGAGTACGCCGACCCCGAGAAGTTCGCGGACTCGGACCAGGACCGGGATCCCCACCGGCTCAACTCGCATCTCAAGCTGGGCTTCGAGGATGTGATCGCAGAGCCGGTGACTACGCACTCCTTTGACAAAGTGTGGATCTGCAGCCATGCCCTCTTTGAAATCAGCAAATACGTAATGTACAAGTTCCTGACGGTGTTCCTGGCCATTCCCCTGGCCTTCATTGCGGGAATTCTCTTTGCCACCCTCAGCTGTCTGCACATCTGGATTTTAATGCCTTTTGTAAAGACCTGCCTAATGGTTCTGCCTTCAGTGCAGACAATATGGAAGAGTGTGACAGATGTTATCATTGCTCCATTGTGTACGAGCGTAGGACGATGCTTCTCTTCTGTCAGCCTGCAACTGAGCCAGGATTGA

Back to List