Details for gene: FOXC1


Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.


Symbol
FOXC1
Name
forkhead box C1
Entrez ID
2296
Ensembl ID
ENSG00000054598    (more details)
KEGG ID
hsa:2296    (more details)
OMIM ID
601090
Uniprot ID
Q12948  
GO ID
hsa:2296    (more details)
Chromosome
6
Strand
1
Start
1609915
End
1613897
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-133b (RPM: 3.2122) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-548at-5p (RPM: 0.3546) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-765 (RPM: 0.4272) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-4779 (RPM: 0.024) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-5006-3p (RPM: 0.4468) / hsa-miR-5688 (RPM: 0.6258) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-9-5p (RPM: 3525.806) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-149-5p (RPM: 312.3098) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-4446-5p (RPM: 0.0052) / hsa-miR-3136-5p (RPM: 0.0576) / hsa-miR-1236-3p (RPM: 0.007) / hsa-miR-4796-3p (RPM: 0.125) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-548ah-5p (RPM: 1.0636) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-4755-5p (RPM: 0.0232) / hsa-miR-500a-5p (RPM: 1.3064) / hsa-miR-548l (RPM: 0.078) / hsa-miR-561-5p (RPM: 7.8542) / hsa-miR-139-5p (RPM: 36.887) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-4742-5p (RPM: 0.1632) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-4782-3p (RPM: 0.0012) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-200b-5p (RPM: 9.0166) / hsa-miR-219a-5p (RPM: 0.9656) / hsa-miR-940 (RPM: 4.614) / hsa-miR-378b (RPM: 0.313) / hsa-miR-378c (RPM: 29.1044) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-185-3p (RPM: 4.0636) / hsa-miR-450a-1-3p (RPM: 0.0026) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-561-3p (RPM: 0.023) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-4646-3p (RPM: 0.0262) / hsa-miR-200a-5p (RPM: 14.0094) / hsa-miR-1292-5p (RPM: 0.815) / hsa-miR-4439 (RPM: 0.0062) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-223-5p (RPM: 0.4706) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-943 (RPM: 0.9912) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-600 (RPM: 0.005) / hsa-miR-3175 (RPM: 0.2046) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-4477a (RPM: 0.0024) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-4748 (RPM: 0.0836) / hsa-miR-3199 (RPM: 0.1412) / hsa-miR-3609 (RPM: 6.639) / hsa-miR-139-3p (RPM: 0.998) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-639 (RPM: 0.005) / hsa-miR-483-5p (RPM: 0.9526) / hsa-miR-324-5p (RPM: 32.337) / hsa-miR-548e-5p (RPM: 0.4844) / hsa-miR-605-3p (RPM: 0.1834) / hsa-miR-6758-5p (RPM: 0.0478) / hsa-miR-6856-5p (RPM: 0.003) / hsa-miR-6857-3p (RPM: 0.0058) / hsa-miR-6830-5p (RPM: 0.0054) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-6733-5p (RPM: 0.449) / hsa-miR-6739-5p (RPM: 0.0102) / hsa-miR-6809-5p (RPM: 0.0616) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-6832-3p (RPM: 0.003) / hsa-miR-6766-3p (RPM: 0.1518) / hsa-miR-7151-3p (RPM: 0.0092) / hsa-miR-329-5p (RPM: 0.196) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6758-3p (RPM: 0.0132) / hsa-miR-6783-5p (RPM: 0.0136) / hsa-miR-7156-3p (RPM: 0.0008) / hsa-miR-6855-3p (RPM: 0.024) / hsa-miR-518a-3p (RPM: 0.0704) / hsa-miR-6513-5p (RPM: 0.1884) / hsa-miR-6895-5p (RPM: 0.3264) / hsa-miR-4433b-5p (RPM: 0.1448) /
Involved Diseases
primary open-angle glaucoma / glaucoma /
Involved Pathways
Sequence
ATGCAGGCGCGCTACTCCGTGTCCAGCCCCAACTCCCTGGGAGTGGTGCCCTACCTCGGCGGCGAGCAGAGCTACTACCGCGCGGCGGCCGCGGCGGCCGGGGGCGGCTACACCGCCATGCCGGCCCCCATGAGCGTGTACTCGCACCCTGCGCACGCCGAGCAGTACCCGGGCGGCATGGCCCGCGCCTACGGGCCCTACACGCCGCAGCCGCAGCCCAAGGACATGGTGAAGCCGCCCTATAGCTACATCGCGCTCATCACCATGGCCATCCAGAACGCCCCGGACAAGAAGATCACCCTGAACGGCATCTACCAGTTCATCATGGACCGCTTCCCCTTCTACCGGGACAACAAGCAGGGCTGGCAGAACAGCATCCGCCACAACCTCTCGCTCAACGAGTGCTTCGTCAAGGTGCCGCGCGACGACAAGAAGCCGGGCAAGGGCAGCTACTGGACGCTGGACCCGGACTCCTACAACATGTTCGAGAACGGCAGCTTCCTGCGGCGGCGGCGGCGCTTCAAGAAGAAGGACGCGGTGAAGGACAAGGAGGAGAAGGACAGGCTGCACCTCAAGGAGCCGCCCCCGCCCGGCCGCCAGCCCCCGCCCGCGCCGCCGGAGCAGGCCGACGGCAACGCGCCCGGTCCGCAGCCGCCGCCCGTGCGCATCCAGGACATCAAGACCGAGAACGGTACGTGCCCCTCGCCGCCCCAGCCCCTGTCCCCGGCCGCCGCCCTGGGCAGCGGCAGCGCCGCCGCGGTGCCCAAGATCGAGAGCCCCGACAGCAGCAGCAGCAGCCTGTCCAGCGGGAGCAGCCCCCCGGGCAGCCTGCCGTCGGCGCGGCCGCTCAGCCTGGACGGTGCGGATTCCGCGCCGCCGCCGCCCGCGCCCTCCGCCCCGCCGCCGCACCATAGCCAGGGCTTCAGCGTGGACAACATCATGACGTCGCTGCGGGGGTCGCCGCAGAGCGCGGCCGCGGAGCTCAGCTCCGGCCTTCTGGCCTCGGCGGCCGCGTCCTCGCGCGCGGGGATCGCACCCCCGCTGGCGCTCGGCGCCTACTCGCCCGGCCAGAGCTCCCTCTACAGCTCCCCCTGCAGCCAGACCTCCAGCGCGGGCAGCTCGGGCGGCGGCGGCGGCGGCGCGGGGGCCGCGGGGGGCGCGGGCGGCGCCGGGACCTACCACTGCAACCTGCAAGCCATGAGCCTGTACGCGGCCGGCGAGCGCGGGGGCCACTTGCAGGGCGCGCCCGGGGGCGCGGGCGGCTCGGCCGTGGACGACCCCCTGCCCGACTACTCTCTGCCTCCGGTCACCAGCAGCAGCTCGTCGTCCCTGAGTCACGGCGGCGGCGGCGGCGGCGGCGGGGGAGGCCAGGAGGCCGGCCACCACCCTGCGGCCCACCAAGGCCGCCTCACCTCGTGGTACCTGAACCAGGCGGGCGGAGACCTGGGCCACTTGGCGAGCGCGGCGGCGGCGGCGGCGGCCGCAGGCTACCCGGGCCAGCAGCAGAACTTCCACTCGGTGCGGGAGATGTTCGAGTCACAGAGGATCGGCTTGAACAACTCTCCAGTGAACGGGAATAGTAGCTGTCAAATGGCCTTCCCTTCCAGCCAGTCTCTGTACCGCACGTCCGGAGCTTTCGTCTACGACTGTAGCAAGTTTTGA

Back to List