Details for gene: MIR221


microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]


Symbol
MIR221
Name
microRNA 221
Entrez ID
407006
Ensembl ID
ENSG00000207870    (more details)
KEGG ID
hsa:407006    (more details)
OMIM ID
300568
Uniprot ID
 
GO ID
hsa:407006  
Chromosome
X
Strand
-1
Start
45746157
End
45746266
miRNA Interactions
Involved Diseases
cataract /
Involved Pathways
MicroRNAs in cancer /
Sequence
TGAACATCCAGGTCTGGGGCATGAACCTGGCATACAATGTAGATTTCTGTGTTCGTTAGGCAACAGCTACATTGTCTGCTGGGTTTCAGGCTACCTGGAAACATGTTCTC

Back to List