Details for gene: FNDC3B


Interacting selectively and non-covalently with an RNA molecule or a portion thereof.


Symbol
FNDC3B
Name
fibronectin type III domain containing 3B
Entrez ID
64778
Ensembl ID
ENSG00000075420    (more details)
KEGG ID
hsa:64778    (more details)
OMIM ID
611909
Uniprot ID
Q53EP0  
GO ID
hsa:64778    (more details)
Chromosome
3
Strand
1
Start
172039578
End
172401669
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-1277-5p (RPM: 3.0234) / hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-216a-5p (RPM: 20.4176) / hsa-miR-548at-5p (RPM: 0.3546) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-1304-5p (RPM: 0.1148) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-455-5p (RPM: 19.0882) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-922 (RPM: 0.0014) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-493-5p (RPM: 18.0762) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-5688 (RPM: 0.6258) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-548e-3p (RPM: 1.2898) / hsa-miR-330-5p (RPM: 48.9814) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-582-3p (RPM: 12.5308) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-548d-3p (RPM: 0.0012) / hsa-miR-125b-2-3p (RPM: 492.7724) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-452-5p (RPM: 23.696) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-4649-3p (RPM: 0.0112) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-4422 (RPM: 0.1276) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-1827 (RPM: 0.03) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-548k (RPM: 8.758) / hsa-let-7f-1-3p (RPM: 9.5776) / hsa-let-7b-3p (RPM: 92.0818) / hsa-miR-1226-3p (RPM: 2.778) / hsa-miR-4722-5p (RPM: 0.0332) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-577 (RPM: 1.8138) / hsa-miR-543 (RPM: 3.6486) / hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-876-5p (RPM: 0.4744) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-190a-5p (RPM: 14.2908) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-513b-5p (RPM: 0.2552) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-4696 (RPM: 0.001) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-548l (RPM: 0.078) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-616-5p (RPM: 3.0294) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-888-5p (RPM: 0.8278) / hsa-miR-589-3p (RPM: 1.3938) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-1228-3p (RPM: 1.304) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-1229-3p (RPM: 1.3764) / hsa-miR-940 (RPM: 4.614) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-1299 (RPM: 7.6252) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-1224-5p (RPM: 1.6668) / hsa-miR-653-5p (RPM: 3.9202) / hsa-miR-642a-5p (RPM: 0.7748) / hsa-miR-641 (RPM: 12.2284) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-148b-5p (RPM: 20.6792) / hsa-miR-708-3p (RPM: 46.9334) / hsa-miR-5682 (RPM: 0.013) / hsa-miR-450a-1-3p (RPM: 0.0026) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-618 (RPM: 4.5528) / hsa-miR-4768-3p (RPM: 0.002) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-573 (RPM: 0.0074) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-371b-5p (RPM: 0.0798) / hsa-miR-527 (RPM: 0.0002) / hsa-miR-518a-5p (RPM: 0.0004) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-215-5p (RPM: 12.4448) / hsa-miR-449c-5p (RPM: 1.8038) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-628-3p (RPM: 10.2162) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-192-5p (RPM: 3146.8498) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-629-5p (RPM: 7.1172) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-675-5p (RPM: 0.6068) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-627-5p (RPM: 0.771) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-363-3p (RPM: 298.497) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-10b-3p (RPM: 1.0348) / hsa-miR-135a-3p (RPM: 2.5292) / hsa-miR-4691-3p (RPM: 0.0364) / hsa-miR-34a-3p (RPM: 0.9902) / hsa-miR-183-3p (RPM: 43.8344) / hsa-miR-760 (RPM: 7.6702) / hsa-miR-3622b-5p (RPM: 0.0704) / hsa-miR-15a-3p (RPM: 0.0624) / hsa-miR-654-3p (RPM: 97.06) / hsa-miR-576-3p (RPM: 1.0164) / hsa-miR-4473 (RPM: 0.2418) / hsa-miR-194-3p (RPM: 0.633) / hsa-miR-1275 (RPM: 5.7258) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-4749-5p (RPM: 0.337) / hsa-miR-625-3p (RPM: 10.649) / hsa-miR-100-5p (RPM: 3365.0918) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-3145-5p (RPM: 0.2498) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-99a-5p (RPM: 1181.6944) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-331-5p (RPM: 4.2262) / hsa-miR-937-3p (RPM: 2.0792) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-423-3p (RPM: 1928.5158) / hsa-miR-7977 (RPM: 18.3058) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-6851-5p (RPM: 0.0318) / hsa-miR-6848-5p (RPM: 0.0366) / hsa-miR-6846-5p (RPM: 0.0114) / hsa-miR-6808-5p (RPM: 0.0032) / hsa-miR-383-3p (RPM: 0.0168) / hsa-miR-6893-5p (RPM: 0.0066) / hsa-miR-6513-5p (RPM: 0.1884) / hsa-miR-4706 (RPM: 0.1162) / hsa-miR-6874-5p (RPM: 0.0102) / hsa-miR-4466 (RPM: 0.2402) /
Involved Diseases
primary open-angle glaucoma / glaucoma / Keratoconus /
Involved Pathways
Sequence
ATGTACGTCACAATGATGATGACCGACCAAATCCCTCTGGAACTGCCACCATTGCTGAACGGAGAGGTAGCCATGATGCCCCACTTGGTGAATGGAGATGCAGCTCAGCAGGTTATTCTCGTTCAAGTTAATCCAGGTGAGACTTTCACAATAAGAGCAGAGGATGGAACACTTCAGTGCATTCAAGGACCTGCTGAAGTTCCCATGATGTCACCCAATGGATCCATTCCTCCCATTCATGTGCCTCCAGGTTATATCTCACAGGTGATTGAAGATAGTACTGGAGTCCGCCGGGTGGTGGTCACACCCCAGTCTCCTGAGTGTTATCCCCCAAGCTACCCCTCAGCCATGTCTCCAACCCATCATCTCCCTCCCTATCTGACTCACCATCCACATTTTATTCATAACTCACACACGGCTTACTACCCACCTGTTACCGGACCTGGAGATATGCCGCCTCAGTTTTTTCCCCAGCATCATCTTCCCCACACAATATATGGTGAGCAAGAAATTATACCATTTTATGGAATGTCAACCTACATCACCCGAGAAGACCAGTACAGCAAGCCTCCGCACAAAAAACTGAAAGACCGCCAGATCGATCGCCAGAACCGCCTCAACAGCCCTCCTTCTTCTATCTACAAAAGCAGCTGCACAACAGTATACAATGGCTATGGGAAGGGCCATAGTGGTGGAAGTGGCGGAGGCGGCAGCGGTAGTGGTCCCGGAATTAAGAAAACAGAGCGACGAGCAAGAAGCAGCCCAAAGTCGAATGATTCAGACTTGCAAGAATATGAGTTGGAAGTAAAGAGGGTGCAAGACATTCTTTCGGGAATAGAGAAACCACAGGTTTCTAATATTCAGGCAAGAGCAGTTGTGTTGTCCTGGGCTCCCCCTGTTGGACTTTCCTGTGGACCCCACAGTGGTCTTTCCTTCCCCTACAGTTACGAGGTGGCCTTATCAGACAAAGGACGAGATGGAAAATACAAGATAATTTACAGTGGAGAAGAATTAGAATGTAACCTGAAAGATCTTAGACCAGCAACAGATTATCATGTGAGGGTGTATGCCATGTACAATTCCGTAAAGGGATCCTGCTCCGAGCCTGTTAGCTTCACCACCCACAGCTGTGCACCCGAGTGTCCTTTCCCCCCTAAGCTGGCACATAGGAGCAAAAGTTCACTAACCCTGCAGTGGAAGGCACCAATTGACAACGGTTCAAAAATCACCAACTACCTTTTAGAGTGGGATGAGGGAAAAAGAAATAGTGGTTTCAGACAGTGCTTCTTCGGGAGCCAGAAGCACTGCAAGTTGACAAAGCTTTGTCCGGCAATGGGGTACACATTCAGGCTGGCCGCTCGAAACGACATTGGTACCAGTGGTTATAGCCAAGAGGTGGTGTGCTACACATTAGGAAATATCCCTCAGATGCCTTCTGCACCAAGGCTGGTTCGAGCTGGCATCACATGGGTCACGTTGCAGTGGAGTAAGCCAGAAGGCTGTTCACCCGAGGAAGTGATCACCTACACCTTGGAAATTCAGGAGGATGAAAATGATAACCTTTTCCACCCAAAATACACTGGAGAGGATTTAACCTGTACTGTGAAAAATCTCAAAAGAAGCACACAGTATAAATTCAGGCTGACTGCTTCTAATACGGAAGGAAAAAGCTGTCCAAGCGAAGTTCTTGTTTGTACGACGAGTCCTGACAGGCCTGGACCTCCTACCAGACCGCTTGTCAAAGGCCCAGTTACATCTCATGGCTTTAGTGTCAAATGGGATCCCCCTAAGGACAATGGTGGTTCAGAAATCCTCAAGTACTTGCTAGAGATTACTGATGGAAATTCTGAAGCGAATCAGTGGGAAGTGGCCTACAGTGGGTCGGCTACCGAATACACCTTCACCCACTTGAAACCAGGCACTTTGTACAAACTCCGAGCATGCTGCATCAGTACCGGCGGACACAGCCAGTGTTCTGAAAGTCTCCCTGTTCGCACACTAAGCATTGCACCAGGTCAATGTCGACCACCGAGGGTTTTGGGTAGACCAAAGCACAAAGAAGTCCACTTAGAGTGGGATGTTCCTGCATCGGAAAGTGGCTGTGAGGTCTCAGAGTACAGCGTGGAGATGACGGAGCCCGAAGACGTAGCCTCGGAAGTGTACCATGGCCCAGAGCTGGAGTGCACCGTCGGCAACCTGCTTCCTGGAACCGTGTATCGCTTCCGGGTGAGGGCTCTGAATGATGGAGGGTATGGTCCCTATTCTGATGTCTCAGAAATTACCACTGCTGCAGGGCCTCCTGGACAATGCAAAGCACCTTGTATTTCTTGTACACCTGATGGATGTGTCTTAGTGGGTTGGGAGAGTCCTGATAGTTCTGGTGCTGACATCTCAGAGTACAGGTTGGAATGGGGAGAAGATGAAGAATCCTTAGAACTCATTTATCATGGGACAGACACCCGTTTTGAAATAAGAGACCTGTTGCCTGCTGCACAGTATTGCTGTAGACTACAGGCCTTCAATCAAGCAGGGGCAGGGCCGTACAGTGAACTTGTCCTTTGCCAGACGCCAGCGTCTGCCCCTGACCCCGTCTCCACTCTCTGTGTCCTGGAGGAGGAGCCCCTTGATGCCTACCCTGATTCACCTTCTGCGTGCCTTGTACTGAACTGGGAAGAGCCGTGCAATAACGGATCTGAAATCCTTGCTTACACCATTGATCTAGGAGACACTAGCATTACCGTGGGCAACACCACCATGCATGTTATGAAAGATCTCCTTCCAGAAACCACCTACCGGATCAGAATTCAGGCTATAAATGAAATTGGAGCTGGACCATTTAGTCAGTTCATTAAAGCAAAAACTCGGCCATTACCACCCTTGCCTCCTAGGCTAGAATGTGCTGCTGCTGGTCCTCAGAGCCTGAAGCTAAAATGGGGAGACAGTAACTCCAAGACACATGCTGCTGAGGACATTGTGTACACACTACAGCTGGAGGACAGAAACAAGAGGTTTATTTCAATCTACAGAGGACCCAGCCACACCTACAAGGTCCAGAGACTGACGGAATTCACATGCTACTCCTTCAGAATCCAGGCAGCAAGCGAGGCTGGAGAAGGGCCCTTCTCAGAAACCTATACCTTCAGCACAACCAAAAGTGTCCCCCCCACCATCAAAGCACCTCGAGTAACACAGTTAGAAGGAAATTCATGTGAAATTTTATGGGAGACGGTACCATCAATGAAAGGTGACCCTGTTAACTACATTCTGCAGGTATTGGTTGGAAGAGAATCTGAGTACAAACAGGTGTACAAGGGAGAAGAAGCCACATTCCAAATCTCAGGCCTCCAGACCAACACAGACTACAGGTTCCGCGTATGTGCGTGTCGTCGCTGTTTAGACACCTCTCAGGAGCTAAGCGGAGCCTTCAGCCCCTCTGCGGCTTTTGTATTACAACGAAGTGAGGTCATGCTTACAGGGGACATGGGGAGCTTAGATGATCCCAAAATGAAGAGCATGATGCCTACTGATGAACAGTTTGCAGCCATCATTGTGCTTGGCTTTGCAACTTTGTCCATTTTATTTGCCTTTATATTACAGTACTTCTTAATGAAGTAA

Back to List