Details for gene: DDIT3


Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription.


Symbol
DDIT3
Name
DNA damage inducible transcript 3
Entrez ID
1649
Ensembl ID
ENSG00000175197    (more details)
KEGG ID
hsa:1649    (more details)
OMIM ID
126337
Uniprot ID
P0DPQ6  
GO ID
hsa:1649    (more details)
Chromosome
12
Strand
-1
Start
57516588
End
57521737
miRNA Interactions
hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-491-5p (RPM: 1.4644) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-135a-3p (RPM: 2.5292) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-4645-3p (RPM: 0.3708) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-7845-5p (RPM: 0.1418) /
Involved Diseases
glaucoma /
Involved Pathways
MAPK signaling pathway / Protein processing in endoplasmic reticulum / Transcriptional misregulation in cancer / Apoptosis / Non-alcoholic fatty liver disease (NAFLD) / Alzheimer's disease / Parkinson's disease / Amyotrophic lateral sclerosis (ALS) / Prion diseases / Lipid and atherosclerosis / Pathways of neurodegeneration - multiple diseases /
Sequence
ATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAGCAGCGCATGAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACGGCTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGATTGACCGAATGGTGAATCTGCACCAAGCATGA

Back to List