Details for gene: NR3C1


Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid).


Symbol
NR3C1
Name
nuclear receptor subfamily 3 group C member 1
Entrez ID
2908
Ensembl ID
ENSG00000113580    (more details)
KEGG ID
hsa:2908    (more details)
OMIM ID
138040
Uniprot ID
P04150  
GO ID
hsa:2908    (more details)
Chromosome
5
Strand
-1
Start
143277931
End
143435512
miRNA Interactions
hsa-miR-548ar-3p (RPM: 0.052) / hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-1277-5p (RPM: 3.0234) / hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-4795-3p (RPM: 0.0626) / hsa-miR-548f-3p (RPM: 0.277) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-1304-5p (RPM: 0.1148) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-377-3p (RPM: 4.0398) / hsa-miR-5582-3p (RPM: 0.0138) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-4672 (RPM: 0.0486) / hsa-miR-544a (RPM: 0.082) / hsa-miR-1237-3p (RPM: 0.1416) / hsa-miR-524-5p (RPM: 0.0032) / hsa-miR-5586-5p (RPM: 0.0126) / hsa-miR-520d-5p (RPM: 0.0084) / hsa-miR-3941 (RPM: 0.0008) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-339-5p (RPM: 44.716) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-144-3p (RPM: 6.9904) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-548a-3p (RPM: 0.0396) / hsa-miR-5006-3p (RPM: 0.4468) / hsa-miR-548e-3p (RPM: 1.2898) / hsa-miR-330-5p (RPM: 48.9814) / hsa-miR-603 (RPM: 0.0052) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-589-5p (RPM: 54.2348) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-5193 (RPM: 0.0094) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-365b-3p (RPM: 22.318) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-3909 (RPM: 20.8842) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-2355-3p (RPM: 0.4574) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-5580-3p (RPM: 0.0162) / hsa-miR-3162-5p (RPM: 0.0012) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-4446-5p (RPM: 0.0052) / hsa-miR-3150b-3p (RPM: 0.0582) / hsa-miR-4796-3p (RPM: 0.125) / hsa-miR-204-5p (RPM: 265062.0076) / hsa-miR-548ah-5p (RPM: 1.0636) / hsa-miR-576-5p (RPM: 10.7352) / hsa-miR-211-5p (RPM: 11706.6776) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-4755-5p (RPM: 0.0232) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-4699-3p (RPM: 0.0196) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-362-3p (RPM: 1.4456) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-329-3p (RPM: 4.2748) / hsa-miR-33a-3p (RPM: 1.692) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-466 (RPM: 0.1392) / hsa-miR-219a-5p (RPM: 0.9656) / hsa-miR-378b (RPM: 0.313) / hsa-miR-378c (RPM: 29.1044) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-378f (RPM: 0.9286) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-496 (RPM: 1.0276) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-222-5p (RPM: 13.2904) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-4517 (RPM: 0.0368) / hsa-miR-19a-5p (RPM: 0.3142) / hsa-miR-192-3p (RPM: 0.4144) / hsa-miR-378d (RPM: 8.7748) / hsa-miR-378e (RPM: 0.1206) / hsa-miR-660-3p (RPM: 0.609) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-3934-5p (RPM: 0.4022) / hsa-miR-622 (RPM: 0.0046) / hsa-miR-618 (RPM: 4.5528) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-29b-2-5p (RPM: 5.083) / hsa-miR-4646-3p (RPM: 0.0262) / hsa-miR-422a (RPM: 0.3564) / hsa-miR-5585-3p (RPM: 0.2034) / hsa-miR-1263 (RPM: 0.006) / hsa-miR-433-3p (RPM: 9.0888) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-3158-3p (RPM: 13.2892) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-629-5p (RPM: 7.1172) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-3613-5p (RPM: 2.9544) / hsa-miR-363-3p (RPM: 298.497) / hsa-miR-3130-3p (RPM: 0.4636) / hsa-miR-4714-3p (RPM: 0.0838) / hsa-miR-378i (RPM: 9.2716) / hsa-miR-660-5p (RPM: 107.579) / hsa-miR-4423-3p (RPM: 0.0508) / hsa-miR-1179 (RPM: 0.9322) / hsa-miR-99b-3p (RPM: 43.962) / hsa-miR-3609 (RPM: 6.639) / hsa-miR-125b-1-3p (RPM: 418.646) / hsa-miR-3622a-5p (RPM: 0.92) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-99a-3p (RPM: 26.3048) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-190a-3p (RPM: 0.756) / hsa-miR-8485 (RPM: 0.0894) / hsa-miR-6720-5p (RPM: 0.0746) / hsa-miR-6868-3p (RPM: 0.3062) / hsa-miR-133a-5p (RPM: 2.2622) / hsa-miR-3928-5p (RPM: 0.2808) / hsa-miR-6806-3p (RPM: 0.0878) / hsa-miR-6849-3p (RPM: 0.0148) / hsa-miR-6852-3p (RPM: 0.0022) / hsa-miR-5088-3p (RPM: 0.3748) / hsa-miR-6768-5p (RPM: 0.0034) / hsa-miR-6131 (RPM: 0.0044) / hsa-miR-6757-5p (RPM: 0.0978) / hsa-miR-511-3p (RPM: 0.1802) / hsa-miR-4433b-5p (RPM: 0.1448) / hsa-miR-6800-3p (RPM: 0.2108) /
Involved Diseases
glaucoma /
Involved Pathways
Neuroactive ligand-receptor interaction / Potential therapeutics for SARS / Circadian Clock / Regulation of RUNX2 expression and activity / FOXO-mediated transcription of oxidative stress, metabolic and neuronal genes / HSP90 chaperone cycle for SHRs / Nuclear Receptor transcription pathway / SUMOylation of intracellular receptors / PTK6 Expression /
Sequence
ATGGACTCCAAAGAATCATTAACTCCTGGTAGAGAAGAAAACCCCAGCAGTGTGCTTGCTCAGGAGAGGGGAGATGTGATGGACTTCTATAAAACCCTAAGAGGAGGAGCTACTGTGAAGGTTTCTGCGTCTTCACCCTCACTGGCTGTCGCTTCTCAATCAGACTCCAAGCAGCGAAGACTTTTGGTTGATTTTCCAAAAGGCTCAGTAAGCAATGCGCAGCAGCCAGATCTGTCCAAAGCAGTTTCACTCTCAATGGGACTGTATATGGGAGAGACAGAAACAAAAGTGATGGGAAATGACCTGGGATTCCCACAGCAGGGCCAAATCAGCCTTTCCTCGGGGGAAACAGACTTAAAGCTTTTGGAAGAAAGCATTGCAAACCTCAATAGGTCGACCAGTGTTCCAGAGAACCCCAAGAGTTCAGCATCCACTGCTGTGTCTGCTGCCCCCACAGAGAAGGAGTTTCCAAAAACTCACTCTGATGTATCTTCAGAACAGCAACATTTGAAGGGCCAGACTGGCACCAACGGTGGCAATGTGAAATTGTATACCACAGACCAAAGCACCTTTGACATTTTGCAGGATTTGGAGTTTTCTTCTGGGTCCCCAGGTAAAGAGACGAATGAGAGTCCTTGGAGATCAGACCTGTTGATAGATGAAAACTGTTTGCTTTCTCCTCTGGCGGGAGAAGACGATTCATTCCTTTTGGAAGGAAACTCGAATGAGGACTGCAAGCCTCTCATTTTACCGGACACTAAACCCAAAATTAAGGATAATGGAGATCTGGTTTTGTCAAGCCCCAGTAATGTAACACTGCCCCAAGTGAAAACAGAAAAAGAAGATTTCATCGAACTCTGCACCCCTGGGGTAATTAAGCAAGAGAAACTGGGCACAGTTTACTGTCAGGCAAGCTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAGCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGTCATTATGGAGTCTTAACTTGTGGAAGCTGTAAAGTTTTCTTCAAAAGAGCAGTGGAAGGACAGCACAATTACCTATGTGCTGGAAGGAATGATTGCATCATCGATAAAATTCGAAGAAAAAACTGCCCAGCATGCCGCTATCGAAAATGTCTTCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAGGCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCTGCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAAGTGTTATATGCAGGATATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGACTACGCTCAACATGTTAGGAGGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGTTCCTAAGGACGGTCTGAAGAGCCAAGAGCTATTTGATGAAATTAGAATGACCTACATCAAAGAGCTAGGAAAAGCCATTGTCAAGAGGGAAGGAAACTCCAGCCAGAACTGGCAGCGGTTTTATCAACTGACAAAACTCTTGGATTCTATGCATGAAGTGGTTGAAAATCTCCTTAACTATTGCTTCCAAACATTTTTGGATAAGACCATGAGTATTGAATTCCCCGAGATGTTAGCTGAAATCATCACCAATCAGATACCAAAATATTCAAATGGAAATATCAAAAAACTTCTGTTTCATCAAAAGTGA

Back to List