Details for gene: MMP1


This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down the interstitial collagens, including types I, II, and III. The gene is part of a cluster of MMP genes on chromosome 11. Mutations in this gene are associated with chronic obstructive pulmonary disease (COPD). Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed.


Symbol
MMP1
Name
matrix metallopeptidase 1
Entrez ID
4312
Ensembl ID
ENSG00000196611    (more details)
KEGG ID
hsa:4312    (more details)
OMIM ID
120353
Uniprot ID
P03956  
GO ID
hsa:4312    (more details)
Chromosome
11
Strand
-1
Start
102789401
End
102798160
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-520c-3p (RPM: 0.0046) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-488-3p (RPM: 11.3394) / hsa-miR-372-3p (RPM: 0.0034) / hsa-miR-520f-3p (RPM: 0.0042) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-145-5p (RPM: 548.8656) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-941 (RPM: 399.631) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
glaucoma /
Involved Pathways
Pathways in cancer / Bladder cancer / Rheumatoid arthritis / Interleukin-4 and Interleukin-13 signaling / Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) / Collagen degradation / Degradation of the extracellular matrix / Activation of Matrix Metalloproteinases / Basigin interactions / PPAR signaling pathway / Lipid and atherosclerosis / Coronavirus disease - COVID-19 / IL-17 signaling pathway / Relaxin signaling pathway /
Sequence
ATGCACAGCTTTCCTCCACTGCTGCTGCTGCTGTTCTGGGGTGTGGTGTCTCACAGCTTCCCAGCGACTCTAGAAACACAAGAGCAAGATGTGGACTTAGTCCAGAAATACCTGGAAAAATACTACAACCTGAAGAATGATGGGAGGCAAGTTGAAAAGCGGAGAAATAGTGGCCCAGTGGTTGAAAAATTGAAGCAAATGCAGGAATTCTTTGGGCTGAAAGTGACTGGGAAACCAGATGCTGAAACCCTGAAGGTGATGAAGCAGCCCAGATGTGGAGTGCCTGATGTGGCTCAGTTTGTCCTCACTGAGGGGAACCCTCGCTGGGAGCAAACACATCTGACCTACAGGATTGAAAATTACACGCCAGATTTGCCAAGAGCAGATGTGGACCATGCCATTGAGAAAGCCTTCCAACTCTGGAGTAATGTCACACCTCTGACATTCACCAAGGTCTCTGAGGGTCAAGCAGACATCATGATATCTTTTGTCAGGGGAGATCATCGGGACAACTCTCCTTTTGATGGACCTGGAGGAAATCTTGCTCATGCTTTTCAACCAGGCCCAGGTATTGGAGGGGATGCTCATTTTGATGAAGATGAAAGGTGGACCAACAATTTCAGAGAGTACAACTTACATCGTGTTGCAGCTCATGAACTCGGCCATTCTCTTGGACTCTCCCATTCTACTGATATCGGGGCTTTGATGTACCCTAGCTACACCTTCAGTGGTGATGTTCAGCTAGCTCAGGATGACATTGATGGCATCCAAGCCATATATGGACGTTCCCAAAATCCTGTCCAGCCCATCGGCCCACAAACCCCAAAAGCGTGTGACAGTAAGCTAACCTTTGATGCTATAACTACGATTCGGGGAGAAGTGATGTTCTTTAAAGACAGATTCTACATGCGCACAAATCCCTTCTACCCGGAAGTTGAGCTCAATTTCATTTCTGTTTTCTGGCCACAACTGCCAAATGGGCTTGAAGCTGCTTACGAATTTGCCGACAGAGATGAAGTCCGGTTTTTCAAAGGGAATAAGTACTGGGCTGTTCAGGGACAGAATGTGCTACACGGATACCCCAAGGACATCTACAGCTCCTTTGGCTTCCCTAGAACTGTGAAGCATATCGATGCTGCTCTTTCTGAGGAAAACACTGGAAAAACCTACTTCTTTGTTGCTAACAAATACTGGAGGTATGATGAATATAAACGATCTATGGATCCAGGTTATCCCAAAATGATAGCACATGACTTTCCTGGAATTGGCCACAAAGTTGATGCAGTTTTCATGAAAGATGGATTTTTCTATTTCTTTCATGGAACAAGACAATACAAATTTGATCCTAAAACGAAGAGAATTTTGACTCTCCAGAAAGCTAATAGCTGGTTCAACTGCAGGAAAAATTGA

Back to List