Details for gene: EFNA5


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
EFNA5
Name
ephrin A5
Entrez ID
1946
Ensembl ID
ENSG00000184349    (more details)
KEGG ID
hsa:1946    (more details)
OMIM ID
601535
Uniprot ID
P52803  
GO ID
hsa:1946    (more details)
Chromosome
5
Strand
-1
Start
107376894
End
107670937
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-548av-5p (RPM: 0.007) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-548k (RPM: 8.758) / hsa-miR-1305 (RPM: 0.128) / hsa-miR-154-3p (RPM: 0.3366) / hsa-miR-10a-3p (RPM: 0.0878) / hsa-miR-576-5p (RPM: 10.7352) / hsa-miR-487a-3p (RPM: 8.1576) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-548l (RPM: 0.078) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-548i (RPM: 1.7968) / hsa-miR-548ar-5p (RPM: 0.0164) / hsa-miR-548ap-5p (RPM: 0.0048) / hsa-miR-548au-5p (RPM: 0.1902) / hsa-miR-548as-5p (RPM: 0.0316) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548b-5p (RPM: 0.2842) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-548ab (RPM: 0.3238) / hsa-miR-548y (RPM: 0.046) / hsa-miR-548h-5p (RPM: 0.3692) / hsa-miR-219a-5p (RPM: 0.9656) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-548w (RPM: 0.4064) / hsa-miR-548ak (RPM: 0.0892) / hsa-miR-496 (RPM: 1.0276) / hsa-miR-18a-3p (RPM: 5.394) / hsa-miR-548aq-5p (RPM: 0.0114) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-4799-5p (RPM: 0.0586) / hsa-miR-3938 (RPM: 1.6814) / hsa-miR-4798-3p (RPM: 0.001) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-1913 (RPM: 0.4166) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-34a-3p (RPM: 0.9902) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-590-5p (RPM: 0.1536) / hsa-miR-3680-5p (RPM: 0.01) / hsa-miR-3692-3p (RPM: 0.0008) / hsa-miR-362-5p (RPM: 9.5016) / hsa-miR-1179 (RPM: 0.9322) / hsa-miR-500b-5p (RPM: 0.928800000000001) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-454-5p (RPM: 7.7508) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-7157-5p (RPM: 0.0022) / hsa-miR-6747-3p (RPM: 0.3694) / hsa-miR-548ay-5p (RPM: 0.357) / hsa-miR-548bb-5p (RPM: 0.0048) / hsa-miR-548ad-5p (RPM: 0.3028) / hsa-miR-548ae-5p (RPM: 1.1262) / hsa-miR-6883-3p (RPM: 0.2388) / hsa-miR-6787-3p (RPM: 0.1544) / hsa-miR-6715a-3p (RPM: 0.0842) / hsa-miR-6836-3p (RPM: 0.019) / hsa-miR-6829-3p (RPM: 0.0008) / hsa-miR-6791-3p (RPM: 0.0226) / hsa-miR-6794-3p (RPM: 0.1094) / hsa-miR-4639-3p (RPM: 0.01) /
Involved Diseases
glaucoma /
Involved Pathways
Sequence
ATGTTGCACGTGGAGATGTTGACGCTGGTGTTTCTGGTGCTCTGGATGTGTGTGTTCAGCCAGGACCCGGGCTCCAAGGCCGTCGCCGACCGCTACGCTGTCTACTGGAACAGCAGCAACCCCAGATTCCAGAGGGGTGACTACCATATTGATGTCTGTATCAATGACTACCTGGATGTTTTCTGCCCTCACTATGAGGACTCCGTCCCAGAAGATAAGACTGAGCGCTATGTCCTCTACATGGTGAACTTTGATGGCTACAGTGCCTGCGACCACACTTCCAAAGGGTTCAAGAGATGGGAATGTAACCGGCCTCACTCTCCAAATGGACCGCTGAAGTTCTCTGAAAAATTCCAGCTCTTCACTCCCTTTTCTCTAGGATTTGAATTCAGGCCAGGCCGAGAATATTTCTACATCTCCTCTGCAATCCCAGATAATGGAAGAAGGTCCTGTCTAAAGCTCAAAGTCTTTGTGAGACCAACAAATAGCTGTATGAAAACTATAGGTGTTCATGATCGTGTTTTCGATGTTAACGACAAAGTAGAAAATTCATTAGAACCAGCAGATGACACCGTACATGAGTCAGCCGAGCCATCCCGCGGCGAGAACGCGGCACAAACACCAAGGATACCCAGCCGCCTTTTGGCAATCCTACTGTTCCTCCTGGCGATGCTTTTGACATTATAG

Back to List