Details for gene: GLCC


That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid.


Symbol
GLCC
Name
collagen type XVIII alpha 1 chain
Entrez ID
80781
Ensembl ID
ENSG00000182871    (more details)
KEGG ID
hsa:80781    (more details)
OMIM ID
120328
Uniprot ID
D3DSM5  
GO ID
hsa:80781    (more details)
Chromosome
21
Strand
1
Start
45405165
End
45513720
miRNA Interactions
hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-3155a (RPM: 0.0162) / hsa-miR-513a-5p (RPM: 0.3656) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-125a-5p (RPM: 11539.4616) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-4711-5p (RPM: 0.1288) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-3157-5p (RPM: 0.3264) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-5192 (RPM: 0.0024) / hsa-miR-486-3p (RPM: 65.2834) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4254 (RPM: 0.0334) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-450a-1-3p (RPM: 0.0026) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-490-3p (RPM: 5.7068) / hsa-miR-4453 (RPM: 0.0012) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-1292-5p (RPM: 0.815) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-3175 (RPM: 0.2046) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-615-5p (RPM: 0.0058) / hsa-miR-6721-5p (RPM: 0.2712) / hsa-miR-6852-5p (RPM: 0.504) / hsa-miR-7157-5p (RPM: 0.0022) / hsa-miR-6815-3p (RPM: 0.053) / hsa-miR-513b-3p (RPM: 0.1202) / hsa-miR-7155-5p (RPM: 0.0116) / hsa-miR-6749-5p (RPM: 0.0316) /
Involved Diseases
cataract / glaucoma /
Involved Pathways
Protein digestion and absorption / Collagen degradation / Degradation of the extracellular matrix / Extracellular matrix organization / Collagen formation / Collagen biosynthesis and modifying enzymes / Assembly of collagen fibrils and other multimeric structures / Integrin cell surface interactions / Collagen chain trimerization / Activation of Matrix Metalloproteinases / Laminin interactions /
Sequence
ATGGCTCCCTACCCCTGTGGCTGCCACATCCTGCTGCTGCTCTTCTGCTGCCTGGCGGCTGCCCGGGCCAACCTGCTGAACCTGAACTGGCTTTGGTTCAATAATGAGGACACCAGCCATGCAGCTACCACGATCCCTGAGCCCCAGGGGCCCCTGCCTGTGCAGCCCACAGCAGATACCACCACACACGTGACCCCCCGGAATGGTTCCACAGAGCCAGCGACAGCCCCTGGCAGCCCTGAGCCACCCTCAGAGCTGCTGGAAGATGGCCAGGACACCCCCACTTCTGCCGAGAGCCCGGACGCGCCAGAGGAGAACATTGCCGGTGTCGGAGCCGAGATCCTGAACGTGGCCAAAGGCATCCGGAGCTTCGTCCAGCTGTGGAATGACACTGTCCCCACTGAGAGCTTGGCCAGGGCGGAAACCCTGGTCCTGGAGACTCCTGTGGGCCCCCTTGCCCTCGCTGGGCCTTCCAGCACCCCCCAGGAGAATGGGACCACTCTCTGGCCCAGCCGTGGCATTCCTAGCTCTCCGGGCGCCCACACAACCGAGGCTGGCACCTTGCCTGCACCCACCCCATCGCCTCCCTCCCTGGGCAGGCCCTGGGCACCACTCACGGGGCCCTCAGTGCCACCACCATCTTCAGGTAGAGCTTCTCTCTCCTCCTTGCTGGGCGGGGCCCCTCCCTGGGGAAGCCTGCAGGACCCAGACAGCCAAGGACTCTCGCCCGCCGCAGCCGCTCCCAGCCAGCAGCTCCAACGCCCTGACGTCCGCCTGCGCACGCCACTTCTGCACCCCCTGGTGATGGGCTCCCTGGGCAAGCACGCGGCCCCCTCCGCCTTCTCCTCTGGGCTCCCGGGCGCACTGTCTCAGGTCGCAGTCACCACTTTAACCAGGGACAGCGGTGCTTGGGTCTCCCACGTGGCTAACTCTGTGGGGCCGGGTCTTGCTAATAACTCTGCCCTGCTCGGGGCTGACCCCGAGGCCCCCGCCGGTCGCTGCCTGCCCCTGCCACCCTCCCTGCCAGTCTGCGGCCACCTGGGCATCTCACGCTTCTGGCTGCCCAACCACCTCCACCACGAGAGCGGCGAGCAGGTGCGGGCCGGGGCACGGGCGTGGGGGGGCCTGCTGCAGACGCACTGCCACCCCTTCCTCGCCTGGTTCTTCTGCCTGCTGCTGGTCCCCCCATGCGGCAGCGTCCCGCCGCCCGCCCCGCCACCCTGCTGCCAGTTCTGCGAGGCCCTGCAGGATGCGTGTTGGAGCCGCCTGGGCGGGGGCCGGCTGCCCGTCGCCTGTGCCTCGCTCCCGACCCAGGAGGATGGGTACTGTGTGCTCATTGGGCCGGCTGCAGAGCGCATCAGCGAGGAGGTGGGGCTGCTGCAGCTCCTTGGGGACCCCCCGCCCCAGCAGGTCACCCAGACGGATGACCCCGACGTCGGGCTGGCCTACGTCTTTGGGCCAGATGCCAACAGTGGCCAAGTGGCCCGGTACCACTTCCCCAGCCTCTTCTTCCGTGACTTCTCACTGCTGTTCCACATCCGGCCAGCCACAGAGGGCCCAGGGGTGCTGTTCGCCATCACGGACTCGGCGCAGGCCATGGTCTTGCTGGGCGTGAAGCTCTCTGGGGTGCAGGACGGGCACCAGGACATCTCCCTGCTCTACACAGAACCAGGTGCAGGCCAGACCCACACAGCCGCCAGCTTCCGGCTCCCCGCCTTCGTCGGCCAGTGGACACACTTAGCCCTCAGTGTGGCAGGTGGCTTTGTGGCCCTCTACGTGGACTGTGAGGAGTTCCAGAGAATGCCGCTTGCTCGGTCCTCACGGGGCCTGGAGCTGGAGCCTGGCGCCGGGCTCTTCGTGGCTCAGGCGGGGGGAGCGGACCCTGACAAGTTCCAGGGGGTGATCGCTGAGCTGAAGGTGCGCAGGGACCCCCAGGTGAGCCCCATGCACTGCCTGGACGAGGAAGGCGATGACTCAGATGGGGCATCCGGAGACTCTGGCAGCGGGCTCGGGGACGCCCGGGAGCTTCTCAGGGAGGAGACGGGCGCGGCCCTAAAACCCAGGCTCCCCGCGCCACCCCCCGTCACCACGCCACCCTTGGCTGGAGGCAGCAGCACGGAAGATTCCAGAAGTGAAGAAGTCGAGGAGCAGACCACGGTGGCTTCGTTAGGAGCTCAGACACTTCCTGGCTCAGATTCTGTCTCCACGTGGGACGGGAGTGTCCGGACCCCTGGGGGCCGCGTGAAAGAGGGCGGCCTGAAGGGGCAGAAAGGGGAGCCAGGTGTTCCGGGCCCACCTGGCCGGGCAGGCCCCCCAGGATCCCCATGCCTACCTGGTCCCCCGGGTCTCCCGTGCCCAGTGAGTCCCCTGGGTCCTGCAGGCCCAGCGTTGCAAACTGTCCCCGGACCACAAGGACCCCCAGGGCCTCCGGGGAGGGACGGCACCCCTGGAAGGGACGGCGAGCCGGGCGACCCCGGTGAAGACGGAAAGCCGGGCGACACCGGGCCACAAGGCTTCCCCGGGACTCCAGGGGACGTAGGTCCCAAGGGCGACAAGGGAGACCCTGGGGTTGGAGAGAGAGGGCCCCCAGGACCCCAAGGGCCTCCAGGGCCCCCAGGACCCTCCTTCAGACACGACAAGCTGACCTTCATTGACATGGAGGGATCTGGCTTCGGGGGCGATCTGGAGGCCCTGCGGGGTCCTCGAGGCTTCCCTGGACCTCCCGGACCCCCCGGTGTCCCAGGCCTGCCCGGCGAGCCAGGCCGCTTTGGGGTGAACAGCTCCGACGTCCCAGGACCCGCCGGCCTTCCTGGTGTGCCTGGGCGCGAGGGTCCCCCCGGGTTTCCTGGCCTCCCGGGACCCCCAGGCCCTCCGGGAAGAGAGGGGCCCCCAGGAAGGACTGGGCAGAAAGGCAGCCTGGGTGAAGCAGGCGCCCCAGGACATAAGGGGAGCAAGGGAGCCCCCGGTCCTGCTGGTGCTCGTGGGGAGAGCGGCCTGGCAGGAGCCCCCGGACCTGCTGGACCACCAGGCCCCCCTGGGCCCCCTGGGCCCCCAGGACCAGGACTCCCCGCTGGATTTGATGACATGGAAGGCTCCGGGGGGCCCTTCTGGTCAACAGCCCGAAGCGCTGATGGGCCACAGGGACCTCCCGGCCTGCCGGGACTTAAGGGGGATCCTGGCGTGCCTGGGCTGCCGGGGGCGAAGGGAGAAGTTGGAGCAGATGGAGTCCCCGGGTTCCCCGGCCTCCCTGGCAGAGAGGGCATTGCTGGGCCCCAGGGGCCAAAGGGAGACAGAGGCAGCCGGGGAGAAAAGGGAGATCCAGGGAAGGACGGAGTCGGGCAGCCGGGCCTCCCTGGCCCCCCCGGACCCCCGGGACCTGTGGTCTACGTGTCGGAGCAGGACGGATCCGTCCTGAGCGTGCCGGGACCTGAGGGCCGGCCGGGTTTCGCAGGCTTTCCCGGACCTGCAGGACCCAAGGGCAACCTGGGCTCTAAGGGCGAACGAGGCTCCCCGGGACCCAAGGGTGAGAAGGGTGAACCGGGCAGCATCTTCAGCCCCGACGGCGGTGCCCTGGGCCCTGCCCAGAAAGGAGCCAAGGGAGAGCCGGGCTTCCGAGGACCCCCGGGTCCATACGGACGGCCGGGGTACAAGGGAGAGATTGGCTTTCCTGGACGGCCGGGTCGCCCCGGGATGAACGGATTGAAAGGAGAGAAAGGGGAGCCGGGAGATGCCAGCCTTGGATTTGGCATGAGGGGAATGCCCGGCCCCCCAGGACCTCCAGGGCCCCCAGGCCCTCCAGGGACTCCTGTTTACGACAGCAATGTGTTTGCTGAGTCCAGCCGCCCCGGGCCTCCAGGATTGCCAGGGAATCAGGGCCCTCCAGGACCCAAGGGCGCCAAAGGAGAAGTGGGCCCCCCCGGACCACCAGGGCAGTTTCCGTTTGACTTTCTTCAGTTGGAGGCTGAAATGAAGGGGGAGAAGGGAGACCGAGGTGATGCAGGACAGAAAGGCGAAAGGGGGGAGCCCGGGGGCGGCGGTTTCTTCGGCTCCAGCCTGCCCGGCCCCCCCGGCCCCCCAGGCCCACGTGGCTACCCTGGGATTCCAGGTCCCAAGGGAGAGAGCATCCGGGGCCAGCCCGGCCCACCTGGACCTCAGGGACCCCCCGGCATCGGCTACGAGGGGCGCCAGGGCCCTCCCGGCCCCCCAGGCCCCCCAGGGCCCCCTTCATTTCCTGGCCCTCACAGGCAGACTATCAGCGTTCCCGGCCCTCCGGGCCCCCCTGGGCCCCCTGGGCCCCCTGGAACCATGGGCGCCTCCTCAGGGGTGAGGCTCTGGGCTACACGCCAGGCCATGCTGGGCCAGGTGCACGAGGTTCCCGAGGGCTGGCTCATCTTCGTGGCCGAGCAGGAGGAGCTCTACGTCCGCGTGCAGAACGGGTTCCGGAAGGTCCAGCTGGAGGCCCGGACACCACTCCCACGAGGGACGGACAATGAAGTGGCCGCCTTGCAGCCCCCCGTGGTGCAGCTGCACGACAGCAACCCCTACCCGCGGCGGGAGCACCCCCACCCCACCGCGCGGCCCTGGCGGGCAGATGACATCCTGGCCAGCCCCCCTCGCCTGCCCGAGCCCCAGCCCTACCCCGGAGCCCCGCACCACAGCTCCTACGTGCACCTGCGGCCGGCGCGACCCACAAGCCCACCCGCCCACAGCCACCGCGACTTCCAGCCGGTGCTCCACCTGGTTGCGCTCAACAGCCCCCTGTCAGGCGGCATGCGGGGCATCCGCGGGGCCGACTTCCAGTGCTTCCAGCAGGCGCGGGCCGTGGGGCTGGCGGGCACCTTCCGCGCCTTCCTGTCCTCGCGCCTGCAGGACCTGTACAGCATCGTGCGCCGTGCCGACCGCGCAGCCGTGCCCATCGTCAACCTCAAGGACGAGCTGCTGTTTCCCAGCTGGGAGGCTCTGTTCTCAGGCTCTGAGGGTCCGCTGAAGCCCGGGGCACGCATCTTCTCCTTTGACGGCAAGGACGTCCTGAGGCACCCCACCTGGCCCCAGAAGAGCGTGTGGCATGGCTCGGACCCCAACGGGCGCAGGCTGACCGAGAGCTACTGTGAGACGTGGCGGACGGAGGCTCCCTCGGCCACGGGCCAGGCCTCCTCGCTGCTGGGGGGCAGGCTCCTGGGGCAGAGTGCCGCGAGCTGCCATCACGCCTACATCGTGCTCTGCATTGAGAACAGCTTCATGACTGCCTCCAAGTAG

Back to List