Details for gene: AHR


FALSE


Symbol
AHR
Name
aryl hydrocarbon receptor
Entrez ID
196
Ensembl ID
ENSG00000106546    (more details)
KEGG ID
hsa:196    (more details)
OMIM ID
600253
Uniprot ID
P35869  
GO ID
hsa:196    (more details)
Chromosome
7
Strand
1
Start
16916359
End
17346152
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-624-5p (RPM: 0.5246) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-2467-5p (RPM: 3.8758) / hsa-miR-125b-2-3p (RPM: 492.7724) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-429 (RPM: 100.5032) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-4500 (RPM: 0.0022) / hsa-miR-149-5p (RPM: 312.3098) / hsa-miR-7-1-3p (RPM: 13.9534) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-30d-3p (RPM: 57.136) / hsa-let-7b-3p (RPM: 92.0818) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1197 (RPM: 2.7672) / hsa-miR-190a-5p (RPM: 14.2908) / hsa-miR-374b-5p (RPM: 72.7188) / hsa-miR-10a-3p (RPM: 0.0878) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-4451 (RPM: 0.0104) / hsa-miR-545-5p (RPM: 0.3484) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-302d-3p (RPM: 0.0012) / hsa-miR-3152-5p (RPM: 0.2428) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-500a-5p (RPM: 1.3064) / hsa-miR-766-3p (RPM: 5.2956) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-548l (RPM: 0.078) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-18b-5p (RPM: 0.3398) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-302c-3p (RPM: 0.0012) / hsa-miR-302b-3p (RPM: 0.006) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-4458 (RPM: 0.0998) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-450a-1-3p (RPM: 0.0026) / hsa-miR-3659 (RPM: 0.023) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-625-5p (RPM: 10.5462) / hsa-miR-573 (RPM: 0.0074) / hsa-miR-665 (RPM: 0.445) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-4699-5p (RPM: 0.0134) / hsa-miR-16-1-3p (RPM: 0.0972) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-3927-3p (RPM: 0.059) / hsa-miR-3117-3p (RPM: 7.8646) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-550b-2-5p (RPM: 0.0036) / hsa-miR-4761-5p (RPM: 0.0082) / hsa-miR-548ax (RPM: 0.008) / hsa-miR-4645-3p (RPM: 0.3708) / hsa-miR-654-3p (RPM: 97.06) / hsa-miR-576-3p (RPM: 1.0164) / hsa-miR-1227-3p (RPM: 0.046) / hsa-miR-24-2-5p (RPM: 18.574) / hsa-mir-1258 (RPM: 0.6836) / hsa-miR-500a-3p (RPM: 426.0306) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-383-5p (RPM: 1.9172) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-7977 (RPM: 18.3058) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-6831-5p (RPM: 0.0134) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-383-3p (RPM: 0.0168) / hsa-miR-6840-3p (RPM: 0.0218) / hsa-miR-1233-5p (RPM: 0.0624) / hsa-miR-6778-5p (RPM: 0.005) / hsa-miR-6513-5p (RPM: 0.1884) / hsa-miR-6807-5p (RPM: 0.028) /
Involved Diseases
Behcet's disease (BD) / Retinitis pigmentosa (RP) /
Involved Pathways
Phase I - Functionalization of compounds / PPARA activates gene expression / Endogenous sterols / Xenobiotics / Aryl hydrocarbon receptor signalling / Th17 cell differentiation / Cushing syndrome / Chemical carcinogenesis - receptor activation / Chemical carcinogenesis - reactive oxygen species /
Sequence
ATGAACAGCAGCAGCGCCAACATCACCTACGCCAGTCGCAAGCGGCGGAAGCCGGTGCAGAAAACAGTAAAGCCAATCCCAGCTGAAGGAATCAAGTCAAATCCTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTCAGCGTCAGCTACACTGGGCATTAAATCCTTCTCAGTGTACAGAGTCTGGACAAGGAATTGAAGAAGCCACTGGTCTCCCCCAGACAGTAGTCTGTTATAACCCAGACCAGATTCCTCCAGAAAACTCTCCTTTAATGGAGAGGTGCTTCATATGTCGTCTAAGGTGTCTGCTGGATAATTCATCTGGTTTTCTGGCAATGAATTTCCAAGGGAAGTTAAAGTATCTTCATGGACAGAAAAAGAAAGGGAAAGATGGATCAATACTTCCACCTCAGTTGGCTTTGTTTGCGATAGCTACTCCACTTCAGCCACCATCCATACTTGAAATCCGGACCAAAAATTTTATCTTTAGAACCAAACACAAACTAGACTTCACACCTATTGGTTGTGATGCCAAAGGAAGAATTGTTTTAGGATATACTGAAGCAGAGCTGTGCACGAGAGGCTCAGGTTATCAGTTTATTCATGCAGCTGATATGCTTTATTGTGCCGAGTCCCATATCCGAATGATTAAGACTGGAGAAAGTGGCATGATAGTTTTCCGGCTTCTTACAAAAAACAACCGATGGACTTGGGTCCAGTCTAATGCACGCCTGCTTTATAAAAATGGAAGACCAGATTATATCATTGTAACTCAGAGACCACTAACAGATGAGGAAGGAACAGAGCATTTACGAAAACGAAATACGAAGTTGCCTTTTATGTTTACCACTGGAGAAGCTGTGTTGTATGAGGCAACCAACCCTTTTCCTGCCATAATGGATCCCTTACCACTAAGGACTAAAAATGGCACTAGTGGAAAAGACTCTGCTACCACATCCACTCTAAGCAAGGACTCTCTCAATCCTAGTTCCCTCCTGGCTGCCATGATGCAACAAGATGAGTCTATTTATCTCTATCCTGCTTCAAGTACTTCAAGTACTGCACCTTTTGAAAACAACTTTTTCAACGAATCTATGAATGAATGCAGAAATTGGCAAGATAATACTGCACCGATGGGAAATGATACTATCCTGAAACATGAGCAAATTGACCAGCCTCAGGATGTGAACTCATTTGCTGGAGGTCACCCAGGGCTCTTTCAAGATAGTAAAAACAGTGACTTGTACAGCATAATGAAAAACCTAGGCATTGATTTTGAAGACATCAGACACATGCAGAATGAAAAATTTTTCAGAAATGATTTTTCTGGTGAGGTTGACTTCAGAGACATTGACTTAACGGATGAAATCCTGACGTATGTCCAAGATTCTTTAAGTAAGTCTCCCTTCATACCTTCAGATTATCAACAGCAACAGTCCTTGGCTCTGAACTCAAGCTGTATGGTACAGGAACACCTACATCTAGAACAGCAACAGCAACATCACCAAAAGCAAGTAGTAGTGGAGCCACAGCAACAGCTGTGTCAGAAGATGAAGCACATGCAAGTTAATGGCATGTTTGAAAATTGGAACTCTAACCAATTCGTGCCTTTCAATTGTCCACAGCAAGACCCACAACAATATAATGTCTTTACAGACTTACATGGGATCAGTCAAGAGTTCCCCTACAAATCTGAAATGGATTCTATGCCTTATACACAGAACTTTATTTCCTGTAATCAGCCTGTATTACCACAACATTCCAAATGTACAGAGCTGGACTACCCTATGGGGAGTTTTGAACCATCCCCATACCCCACTACTTCTAGTTTAGAAGATTTTGTCACTTGTTTACAACTTCCTGAAAACCAAAAGCATGGATTAAATCCACAGTCAGCCATAATAACTCCTCAGACATGTTATGCTGGGGCCGTGTCGATGTATCAGTGCCAGCCAGAACCTCAGCACACCCACGTGGGTCAGATGCAGTACAATCCAGTACTGCCAGGCCAACAGGCATTTTTAAACAAGTTTCAGAATGGAGTTTTAAATGAAACATATCCAGCTGAATTAAATAACATAAATAACACTCAGACTACCACACATCTTCAGCCACTTCATCATCCGTCAGAAGCCAGACCTTTTCCTGATTTGACATCCAGTGGATTCCTGTAA

Back to List