Details for gene: APOA1


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
APOA1
Name
apolipoprotein A1
Entrez ID
335
Ensembl ID
ENSG00000118137    (more details)
KEGG ID
hsa:335    (more details)
OMIM ID
107680
Uniprot ID
P02647  
GO ID
hsa:335    (more details)
Chromosome
11
Strand
-1
Start
116835751
End
116837622
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
African trypanosomiasis / Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) / Post-translational protein phosphorylation / Platelet degranulation / PPARA activates gene expression / Scavenging by Class A Receptors / Chylomicron assembly / Chylomicron remodeling / HDL remodeling / Retinoid metabolism and transport / ABC transporters in lipid homeostasis / Scavenging of heme from plasma / Scavenging by Class B Receptors / Defective ABCA1 causes TGD / HDL assembly / HDL clearance / Heme signaling / Amyloid fiber formation / PPAR signaling pathway / Fat digestion and absorption / Vitamin digestion and absorption / Cholesterol metabolism / Lipid and atherosclerosis /
Sequence
ATGAAAGCTGCGGTGCTGACCTTGGCCGTGCTCTTCCTGACGGGGAGCCAGGCTCGGCATTTCTGGCAGCAAGATGAACCCCCCCAGAGCCCCTGGGATCGAGTGAAGGACCTGGCCACTGTGTACGTGGATGTGCTCAAAGACAGCGGCAGAGACTATGTGTCCCAGTTTGAAGGCTCCGCCTTGGGAAAACAGCTAAACCTAAAGCTCCTTGACAACTGGGACAGCGTGACCTCCACCTTCAGCAAGCTGCGCGAACAGCTCGGCCCTGTGACCCAGGAGTTCTGGGATAACCTGGAAAAGGAGACAGAGGGCCTGAGGCAGGAGATGAGCAAGGATCTGGAGGAGGTGAAGGCCAAGGTGCAGCCCTACCTGGACGACTTCCAGAAGAAGTGGCAGGAGGAGATGGAGCTCTACCGCCAGAAGGTGGAGCCGCTGCGCGCAGAGCTCCAAGAGGGCGCGCGCCAGAAGCTGCACGAGCTGCAAGAGAAGCTGAGCCCACTGGGCGAGGAGATGCGCGACCGCGCGCGCGCCCATGTGGACGCGCTGCGCACGCATCTGGCCCCCTACAGCGACGAGCTGCGCCAGCGCTTGGCCGCGCGCCTTGAGGCTCTCAAGGAGAACGGCGGCGCCAGACTGGCCGAGTACCACGCCAAGGCCACCGAGCATCTGAGCACGCTCAGCGAGAAGGCCAAGCCCGCGCTCGAGGACCTCCGCCAAGGCCTGCTGCCCGTGCTGGAGAGCTTCAAGGTCAGCTTCCTGAGCGCTCTCGAGGAGTACACTAAGAAGCTCAACACCCAGTGA

Back to List