Details for gene: C4A


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
C4A
Name
complement C4A (Rodgers blood group)
Entrez ID
720
Ensembl ID
ENSG00000244731    (more details)
KEGG ID
hsa:720    (more details)
OMIM ID
120810
Uniprot ID
P0C0L4  
GO ID
hsa:720    (more details)
Chromosome
6
Strand
1
Start
31982057
End
32002681
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Pertussis / Staphylococcus aureus infection / Systemic lupus erythematosus / Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs) / Post-translational protein phosphorylation / Initial triggering of complement / Activation of C3 and C5 / Regulation of Complement cascade / Alcoholic liver disease / Complement and coagulation cascades / Coronavirus disease - COVID-19 /
Sequence
ATGAGGCTGCTCTGGGGGCTGATCTGGGCATCCAGCTTCTTCACCTTATCTCTGCAGAAGCCCAGGTTGCTCTTGTTCTCTCCTTCTGTGGTTCATCTGGGGGTCCCCCTATCGGTGGGGGTGCAGCTCCAGGATGTGCCCCGAGGACAGGTAGTGAAAGGATCAGTGTTCCTGAGAAACCCATCTCGTAATAATGTCCCCTGCTCCCCAAAGGTGGACTTCACCCTTAGCTCAGAAAGAGACTTCGCACTCCTCAGTCTCCAGGTGCCCTTGAAAGATGCGAAGAGCTGTGGCCTCCATCAACTCCTCAGAGGCCCTGAGGTCCAGCTGGTGGCCCATTCGCCATGGCTAAAGGACTCTCTGTCCAGAACGACAAACATCCAGGGTATCAACCTGCTCTTCTCCTCTCGCCGGGGGCACCTCTTTTTGCAGACGGACCAGCCCATTTACAACCCTGGCCAGCGGGTTCGGTACCGGGTCTTTGCTCTGGATCAGAAGATGCGCCCGAGCACTGACACCATCACAGTCATGGTGGAGAACTCTCACGGCCTCCGCGTGCGGAAGAAGGAGGTGTACATGCCCTCGTCCATCTTCCAGGATGACTTTGTGATCCCAGACATCTCAGAGCCAGGGACCTGGAAGATCTCAGCCCGATTCTCAGATGGCCTGGAATCCAACAGCAGCACCCAGTTTGAGGTGAAGAAATATGTCCTTCCCAACTTTGAGGTGAAGATCACCCCTGGAAAGCCCTACATCCTGACGGTGCCAGGCCATCTTGATGAAATGCAGTTAGACATCCAGGCCAGGTACATCTATGGGAAGCCAGTGCAGGGGGTGGCATATGTGCGCTTTGGGCTCCTAGATGAGGATGGTAAGAAGACTTTCTTTCGGGGGCTGGAGAGTCAGACCAAGCTGGTGAATGGACAGAGCCACATTTCCCTCTCAAAGGCAGAGTTCCAGGACGCCCTGGAGAAGCTGAATATGGGCATTACTGACCTCCAGGGGCTGCGCCTCTACGTTGCTGCAGCCATCATTGAGTCTCCAGGTGGGGAGATGGAGGAGGCAGAGCTCACATCCTGGTATTTTGTGTCATCTCCCTTCTCCTTGGATCTTAGCAAGACCAAGCGACACCTTGTGCCTGGGGCCCCCTTCCTGCTGCAGGCCTTGGTCCGTGAGATGTCAGGCTCCCCAGCTTCTGGCATTCCTGTCAAAGTTTCTGCCACGGTGTCTTCTCCTGGGTCTGTTCCTGAAGTCCAGGACATTCAGCAAAACACAGACGGGAGCGGCCAAGTCAGCATTCCAATAATTATCCCTCAGACCATCTCAGAGCTGCAGCTCTCAGTATCTGCAGGCTCCCCACATCCAGCGATAGCCAGGCTCACTGTGGCAGCCCCACCTTCAGGAGGCCCCGGGTTTCTGTCTATTGAGCGGCCGGATTCTCGACCTCCTCGTGTTGGGGACACTCTGAACCTGAACTTGCGAGCCGTGGGCAGTGGGGCCACCTTTTCTCATTACTACTACATGATCCTATCCCGAGGGCAGATCGTGTTCATGAATCGAGAGCCCAAGAGGACCCTGACCTCGGTCTCGGTGTTTGTGGACCATCACCTGGCACCCTCCTTCTACTTTGTGGCCTTCTACTACCATGGAGACCACCCAGTGGCCAACTCCCTGCGAGTGGATGTCCAGGCTGGGGCCTGCGAGGGCAAGCTGGAGCTCAGCGTGGACGGTGCCAAGCAGTACCGGAACGGGGAGTCCGTGAAGCTCCACTTAGAAACCGACTCCCTAGCCCTGGTGGCGCTGGGAGCCTTGGACACAGCTCTGTATGCTGCAGGCAGCAAGTCCCACAAGCCCCTCAACATGGGCAAGGTCTTTGAAGCTATGAACAGCTATGACCTCGGCTGTGGTCCTGGGGGTGGGGACAGTGCCCTTCAGGTGTTCCAGGCAGCGGGCCTGGCCTTTTCTGATGGAGACCAGTGGACCTTATCCAGAAAGAGACTAAGCTGTCCCAAGGAGAAGACAACCCGGAAAAAGAGAAACGTGAACTTCCAAAAGGCGATTAATGAGAAATTGGGTCAGTATGCTTCCCCGACAGCCAAGCGCTGCTGCCAGGATGGGGTGACACGTCTGCCCATGATGCGTTCCTGCGAGCAGCGGGCAGCCCGCGTGCAGCAGCCGGACTGCCGGGAGCCCTTCCTGTCCTGCTGCCAATTTGCTGAGAGTCTGCGCAAGAAGAGCAGGGACAAGGGCCAGGCGGGCCTCCAACGAGCCCTGGAGATCCTGCAGGAGGAGGACCTGATTGATGAGGATGACATTCCCGTGCGCAGCTTCTTCCCAGAGAACTGGCTCTGGAGAGTGGAAACAGTGGACCGCTTTCAAATATTGACACTGTGGCTCCCCGACTCTCTGACCACGTGGGAGATCCATGGCCTGAGCCTGTCCAAAACCAAAGGCCTATGTGTGGCCACCCCAGTCCAGCTCCGGGTGTTCCGCGAGTTCCACCTGCACCTCCGCCTGCCCATGTCTGTCCGCCGCTTTGAGCAGCTGGAGCTGCGGCCTGTCCTCTATAACTACCTGGATAAAAACCTGACTGTGAGCGTCCACGTGTCCCCAGTGGAGGGGCTGTGCCTGGCTGGGGGCGGAGGGCTGGCCCAGCAGGTGCTGGTGCCTGCGGGCTCTGCCCGGCCTGTTGCCTTCTCTGTGGTGCCCACGGCAGCCGCCGCTGTGTCTCTGAAGGTGGTGGCTCGAGGGTCCTTCGAATTCCCTGTGGGAGATGCGGTGTCCAAGGTTCTGCAGATTGAGAAGGAAGGGGCCATCCATAGAGAGGAGCTGGTCTATGAACTCAACCCCTTGGACCACCGAGGCCGGACCTTGGAAATACCTGGCAACTCTGATCCCAATATGATCCCTGATGGGGACTTTAACAGCTACGTCAGGGTTACAGCCTCAGATCCATTGGACACTTTAGGCTCTGAGGGGGCCTTGTCACCAGGAGGCGTGGCCTCCCTCTTGAGGCTTCCTCGAGGCTGTGGGGAGCAAACCATGATCTACTTGGCTCCGACACTGGCTGCTTCCCGCTACCTGGACAAGACAGAGCAGTGGAGCACACTGCCTCCCGAGACCAAGGACCACGCCGTGGATCTGATCCAGAAAGGCTACATGCGGATCCAGCAGTTTCGGAAGGCGGATGGTTCCTATGCGGCTTGGTTGTCACGGGACAGCAGCACCTGGCTCACAGCCTTTGTGTTGAAGGTCCTGAGTTTGGCCCAGGAGCAGGTAGGAGGCTCGCCTGAGAAACTGCAGGAGACATCTAACTGGCTTCTGTCCCAGCAGCAGGCTGACGGCTCGTTCCAGGACCCCTGTCCAGTGTTAGACAGGAGCATGCAGGGGGGTTTGGTGGGCAATGATGAGACTGTGGCACTCACAGCCTTTGTGACCATCGCCCTTCATCATGGGCTGGCCGTCTTCCAGGATGAGGGTGCAGAGCCATTGAAGCAGAGAGTGGAAGCCTCCATCTCAAAGGCAAACTCATTTTTGGGGGAGAAAGCAAGTGCTGGGCTCCTGGGTGCCCACGCAGCTGCCATCACGGCCTATGCCCTGACACTGACCAAGGCGCCTGTGGACCTGCTCGGTGTTGCCCACAACAACCTCATGGCAATGGCCCAGGAGACTGGAGATAACCTGTACTGGGGCTCAGTCACTGGTTCTCAGAGCAATGCCGTGTCGCCCACCCCGGCTCCTCGCAACCCATCCGACCCCATGCCCCAGGCCCCAGCCCTGTGGATTGAAACCACAGCCTACGCCCTGCTGCACCTCCTGCTTCACGAGGGCAAAGCAGAGATGGCAGACCAGGCTTCGGCCTGGCTCACCCGTCAGGGCAGCTTCCAAGGGGGATTCCGCAGTACCCAAGACACGGTGATTGCCCTGGATGCCCTGTCTGCCTACTGGATTGCCTCCCACACCACTGAGGAGAGGGGTCTCAATGTGACTCTCAGCTCCACAGGCCGGAATGGGTTCAAGTCCCACGCGCTGCAGCTGAACAACCGCCAGATTCGCGGCCTGGAGGAGGAGCTGCAGTTTTCCTTGGGCAGCAAGATCAATGTGAAGGTGGGAGGAAACAGCAAAGGAACCCTGAAGGTCCTTCGTACCTACAATGTCCTGGACATGAAGAACACGACCTGCCAGGACCTACAGATAGAAGTGACAGTCAAAGGCCACGTCGAGTACACGATGGAAGCAAACGAGGACTATGAGGACTATGAGTACGATGAGCTTCCAGCCAAGGATGACCCAGATGCCCCTCTGCAGCCCGTGACACCCCTGCAGCTGTTTGAGGGTCGGAGGAACCGCCGCAGGAGGGAGGCGCCCAAGGTGGTGGAGGAGCAGGAGTCCAGGGTGCACTACACCGTGTGCATCTGGCGGAACGGCAAGGTGGGGCTGTCTGGCATGGCCATCGCGGACGTCACCCTCCTGAGTGGATTCCACGCCCTGCGTGCTGACCTGGAGAAGCTGACCTCCCTCTCTGACCGTTACGTGAGTCACTTTGAGACCGAGGGGCCCCACGTCCTGCTGTATTTTGACTCGGTCCCCACCTCCCGGGAGTGCGTGGGCTTTGAGGCTGTGCAGGAAGTGCCGGTGGGGCTGGTGCAGCCGGCCAGCGCAACCCTGTACGACTACTACAACCCCGAGCGCAGATGTTCTGTGTTTTACGGGGCACCAAGTAAGAGCAGACTCTTGGCCACCTTGTGTTCTGCTGAAGTCTGCCAGTGTGCTGAGGGGAAGTGCCCTCGCCAGCGTCGCGCCCTGGAGCGGGGTCTGCAGGACGAGGATGGCTACAGGATGAAGTTTGCCTGCTACTACCCCCGTGTGGAGTACGGCTTCCAGGTTAAGGTTCTCCGAGAAGACAGCAGAGCTGCTTTCCGCCTCTTTGAGACCAAGATCACCCAAGTCCTGCACTTCACCAAGGATGTCAAGGCCGCTGCTAATCAGATGCGCAACTTCCTGGTTCGAGCCTCCTGCCGCCTTCGCTTGGAACCTGGGAAAGAATATTTGATCATGGGTCTGGATGGGGCCACCTATGACCTCGAGGGACACCCCCAGTACCTGCTGGACTCGAATAGCTGGATCGAGGAGATGCCCTCTGAACGCCTGTGCCGGAGCACCCGCCAGCGGGCAGCCTGTGCCCAGCTCAACGACTTCCTCCAGGAGTATGGCACTCAGGGGTGCCAGGTGTGA

Back to List