Details for gene: ICAM1


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
ICAM1
Name
intercellular adhesion molecule 1
Entrez ID
3383
Ensembl ID
ENSG00000090339    (more details)
KEGG ID
hsa:3383    (more details)
OMIM ID
147840
Uniprot ID
P05362  
GO ID
hsa:3383    (more details)
Chromosome
19
Strand
1
Start
10271093
End
10286615
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-125b-5p (RPM: 10044.3546) / hsa-miR-3941 (RPM: 0.0008) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-miR-129-1-3p (RPM: 8.647) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-654-5p (RPM: 2.4606) / hsa-miR-603 (RPM: 0.0052) / hsa-miR-2467-5p (RPM: 3.8758) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-632 (RPM: 0.0074) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-3188 (RPM: 0.6606) / hsa-miR-1226-5p (RPM: 0.426) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-362-3p (RPM: 1.4456) / hsa-miR-329-3p (RPM: 4.2748) / hsa-miR-1256 (RPM: 0.2618) / hsa-miR-92a-1-5p (RPM: 8.113) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-486-3p (RPM: 65.2834) / hsa-miR-466 (RPM: 0.1392) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-141-5p (RPM: 20.664) / hsa-miR-192-3p (RPM: 0.4144) / hsa-miR-1224-5p (RPM: 1.6668) / hsa-miR-641 (RPM: 12.2284) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-3617-5p (RPM: 1.88) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-526b-5p (RPM: 0.2456) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-4643 (RPM: 0.013) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-299-3p (RPM: 3.441) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-1267 (RPM: 0.087) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-134-5p (RPM: 29.8712) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-1255b-5p (RPM: 0.0196) / hsa-miR-296-3p (RPM: 8.5012) / hsa-miR-1255a (RPM: 0.3384) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-8485 (RPM: 0.0894) / hsa-miR-6884-5p (RPM: 0.168) /
Involved Diseases
diabetic retinopathy / Behcet's disease (BD) /
Involved Pathways
Epstein-Barr virus infection / NF-kappa B signaling pathway / HTLV-I infection / Rheumatoid arthritis / Natural killer cell mediated cytotoxicity / TNF signaling pathway / Influenza A / Viral myocarditis / Cell adhesion molecules (CAMs) / Leukocyte transendothelial migration / African trypanosomiasis / Malaria / Staphylococcus aureus infection / Cytokine Signaling in Immune system / Immune System / Signaling by Interleukins / Interleukin-4 and Interleukin-13 signaling / Adaptive Immune System / Extracellular matrix organization / Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell / Integrin cell surface interactions / Interleukin-10 signaling / Interferon gamma signaling / Interferon Signaling / Lipid and atherosclerosis / Kaposi sarcoma-associated herpesvirus infection / AGE-RAGE signaling pathway in diabetic complications / Fluid shear stress and atherosclerosis /
Sequence
ATGGCTCCCAGCAGCCCCCGGCCCGCGCTGCCCGCACTCCTGGTCCTGCTCGGGGCTCTGTTCCCAGGACCTGGCAATGCCCAGACATCTGTGTCCCCCTCAAAAGTCATCCTGCCCCGGGGAGGCTCCGTGCTGGTGACATGCAGCACCTCCTGTGACCAGCCCAAGTTGTTGGGCATAGAGACCCCGTTGCCTAAAAAGGAGTTGCTCCTGCCTGGGAACAACCGGAAGGTGTATGAACTGAGCAATGTGCAAGAAGATAGCCAACCAATGTGCTATTCAAACTGCCCTGATGGGCAGTCAACAGCTAAAACCTTCCTCACCGTGTACTGGACTCCAGAACGGGTGGAACTGGCACCCCTCCCCTCTTGGCAGCCAGTGGGCAAGAACCTTACCCTACGCTGCCAGGTGGAGGGTGGGGCACCCCGGGCCAACCTCACCGTGGTGCTGCTCCGTGGGGAGAAGGAGCTGAAACGGGAGCCAGCTGTGGGGGAGCCCGCTGAGGTCACGACCACGGTGCTGGTGAGGAGAGATCACCATGGAGCCAATTTCTCGTGCCGCACTGAACTGGACCTGCGGCCCCAAGGGCTGGAGCTGTTTGAGAACACCTCGGCCCCCTACCAGCTCCAGACCTTTGTCCTGCCAGCGACTCCCCCACAACTTGTCAGCCCCCGGGTCCTAGAGGTGGACACGCAGGGGACCGTGGTCTGTTCCCTGGACGGGCTGTTCCCAGTCTCGGAGGCCCAGGTCCACCTGGCACTGGGGGACCAGAGGTTGAACCCCACAGTCACCTATGGCAACGACTCCTTCTCGGCCAAGGCCTCAGTCAGTGTGACCGCAGAGGACGAGGGCACCCAGCGGCTGACGTGTGCAGTAATACTGGGGAACCAGAGCCAGGAGACACTGCAGACAGTGACCATCTACAGCTTTCCGGCGCCCAACGTGATTCTGACGAAGCCAGAGGTCTCAGAAGGGACCGAGGTGACAGTGAAGTGTGAGGCCCACCCTAGAGCCAAGGTGACGCTGAATGGGGTTCCAGCCCAGCCACTGGGCCCGAGGGCCCAGCTCCTGCTGAAGGCCACCCCAGAGGACAACGGGCGCAGCTTCTCCTGCTCTGCAACCCTGGAGGTGGCCGGCCAGCTTATACACAAGAACCAGACCCGGGAGCTTCGTGTCCTGTATGGCCCCCGACTGGACGAGAGGGATTGTCCGGGAAACTGGACGTGGCCAGAAAATTCCCAGCAGACTCCAATGTGCCAGGCTTGGGGGAACCCATTGCCCGAGCTCAAGTGTCTAAAGGATGGCACTTTCCCACTGCCCATCGGGGAATCAGTGACTGTCACTCGAGATCTTGAGGGCACCTACCTCTGTCGGGCCAGGAGCACTCAAGGGGAGGTCACCCGCAAGGTGACCGTGAATGTGCTCTCCCCCCGGTATGAGATTGTCATCATCACTGTGGTAGCAGCCGCAGTCATAATGGGCACTGCAGGCCTCAGCACGTACCTCTATAACCGCCAGCGGAAGATCAAGAAATACAGACTACAACAGGCCCAAAAAGGGACCCCCATGAAACCGAACACACAAGCCACGCCTCCCTGA

Back to List