Details for gene: IL10


The process in which SRP binds to the signal peptide in a nascent protein, causing protein elongation to pause, during cotranslational membrane targeting.


Symbol
IL10
Name
interleukin 10
Entrez ID
3586
Ensembl ID
ENSG00000136634    (more details)
KEGG ID
hsa:3586    (more details)
OMIM ID
124092
Uniprot ID
P22301  
GO ID
hsa:3586    (more details)
Chromosome
1
Strand
-1
Start
206767602
End
206774541
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Inflammatory bowel disease (IBD) / FoxO signaling pathway / Cytokine-cytokine receptor interaction / Jak-STAT signaling pathway / Chagas disease (American trypanosomiasis) / Pertussis / Toxoplasmosis / Amoebiasis / Tuberculosis / African trypanosomiasis / Malaria / Staphylococcus aureus infection / Leishmaniasis / T cell receptor signaling pathway / Asthma / Systemic lupus erythematosus / Allograft rejection / Autoimmune thyroid disease / Interleukin-4 and Interleukin-13 signaling / CD163 mediating an anti-inflammatory response / Interleukin-10 signaling / Gene and protein expression by JAK-STAT signaling after Interleukin-12 stimulation / FCGR3A-mediated IL10 synthesis / Viral protein interaction with cytokine and cytokine receptor / Yersinia infection / C-type lectin receptor signaling pathway / Intestinal immune network for IgA production /
Sequence
ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGA

Back to List