Details for gene: IL12A


The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite.


Symbol
IL12A
Name
interleukin 12A
Entrez ID
3592
Ensembl ID
ENSG00000168811    (more details)
KEGG ID
hsa:3592    (more details)
OMIM ID
161560
Uniprot ID
P29459  
GO ID
hsa:3592    (more details)
Chromosome
3
Strand
1
Start
159988835
End
159996019
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Inflammatory bowel disease (IBD) / Pathways in cancer / RIG-I-like receptor signaling pathway / Cytokine-cytokine receptor interaction / Jak-STAT signaling pathway / Chagas disease (American trypanosomiasis) / Pertussis / Legionellosis / Toxoplasmosis / Amoebiasis / Tuberculosis / Measles / Influenza A / Herpes simplex infection / Type I diabetes mellitus / African trypanosomiasis / Malaria / Leishmaniasis / Toll-like receptor signaling pathway / Allograft rejection / Interleukin-4 and Interleukin-13 signaling / Interleukin-10 signaling / Interleukin-12 signaling / Interleukin-35 Signalling / Lipid and atherosclerosis / Alcoholic liver disease / Coronavirus disease - COVID-19 / C-type lectin receptor signaling pathway / Th1 and Th2 cell differentiation /
Sequence
ATGTGGCCCCCTGGGTCAGCCTCCCAGCCACCGCCCTCACCTGCCGCGGCCACAGGTCTGCATCCAGCGGCTCGCCCTGTGTCCCTGCAGTGCCGGCTCAGCATGTGTCCAGCGCGCAGCCTCCTCCTTGTGGCTACCCTGGTCCTCCTGGACCACCTCAGTTTGGCCAGAAACCTCCCCGTGGCCACTCCAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAGACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTAAGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGTGATGAGCTATCTGAATGCTTCCTAA

Back to List