Details for gene: ITGB2


FALSE


Symbol
ITGB2
Name
integrin subunit beta 2
Entrez ID
3689
Ensembl ID
ENSG00000160255    (more details)
KEGG ID
hsa:3689    (more details)
OMIM ID
600065
Uniprot ID
P05107  
GO ID
hsa:3689    (more details)
Chromosome
21
Strand
-1
Start
44885953
End
44931989
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Rap1 signaling pathway / HTLV-I infection / Regulation of actin cytoskeleton / Rheumatoid arthritis / Natural killer cell mediated cytotoxicity / Pertussis / Legionellosis / Amoebiasis / Tuberculosis / Viral myocarditis / Cell adhesion molecules (CAMs) / Leukocyte transendothelial migration / Malaria / Staphylococcus aureus infection / Phagosome / Hippo signaling pathway / Leishmaniasis / Interleukin-4 and Interleukin-13 signaling / Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell / Integrin cell surface interactions / Toll Like Receptor 4 (TLR4) Cascade / Cell surface interactions at the vascular wall / Neutrophil degranulation / Complement and coagulation cascades / Neutrophil extracellular trap formation /
Sequence
ATGCTGGGCCTGCGCCCCCCACTGCTCGCCCTGGTGGGGCTGCTCTCCCTCGGGTGCGTCCTCTCTCAGGAGTGCACGAAGTTCAAGGTCAGCAGCTGCCGGGAATGCATCGAGTCGGGGCCCGGCTGCACCTGGTGCCAGAAGCTGAACTTCACAGGGCCGGGGGATCCTGACTCCATTCGCTGCGACACCCGGCCACAGCTGCTCATGAGGGGCTGTGCGGCTGACGACATCATGGACCCCACAAGCCTCGCTGAAACCCAGGAAGACCACAATGGGGGCCAGAAGCAGCTGTCCCCACAAAAAGTGACGCTTTACCTGCGACCAGGCCAGGCAGCAGCGTTCAACGTGACCTTCCGGCGGGCCAAGGGCTACCCCATCGACCTGTACTATCTGATGGACCTCTCCTACTCCATGCTTGATGACCTCAGGAATGTCAAGAAGCTAGGTGGCGACCTGCTCCGGGCCCTCAACGAGATCACCGAGTCCGGCCGCATTGGCTTCGGGTCCTTCGTGGACAAGACCGTGCTGCCGTTCGTGAACACGCACCCTGATAAGCTGCGAAACCCATGCCCCAACAAGGAGAAAGAGTGCCAGCCCCCGTTTGCCTTCAGGCACGTGCTGAAGCTGACCAACAACTCCAACCAGTTTCAGACCGAGGTCGGGAAGCAGCTGATTTCCGGAAACCTGGATGCACCCGAGGGTGGGCTGGACGCCATGATGCAGGTCGCCGCCTGCCCGGAGGAAATCGGCTGGCGCAACGTCACGCGGCTGCTGGTGTTTGCCACTGATGACGGCTTCCATTTCGCGGGCGACGGGAAGCTGGGCGCCATCCTGACCCCCAACGACGGCCGCTGTCACCTGGAGGACAACTTGTACAAGAGGAGCAACGAATTCGACTACCCATCGGTGGGCCAGCTGGCGCACAAGCTGGCTGAAAACAACATCCAGCCCATCTTCGCGGTGACCAGTAGGATGGTGAAGACCTACGAGAAACTCACCGAGATCATCCCCAAGTCAGCCGTGGGGGAGCTGTCTGAGGACTCCAGCAATGTGGTCCATCTCATTAAGAATGCTTACAATAAACTCTCCTCCAGGGTCTTCCTGGATCACAACGCCCTCCCCGACACCCTGAAAGTCACCTACGACTCCTTCTGCAGCAATGGAGTGACGCACAGGAACCAGCCCAGAGGTGACTGTGATGGCGTGCAGATCAATGTCCCGATCACCTTCCAGGTGAAGGTCACGGCCACAGAGTGCATCCAGGAGCAGTCGTTTGTCATCCGGGCGCTGGGCTTCACGGACATAGTGACCGTGCAGGTTCTTCCCCAGTGTGAGTGCCGGTGCCGGGACCAGAGCAGAGACCGCAGCCTCTGCCATGGCAAGGGCTTCTTGGAGTGCGGCATCTGCAGGTGTGACACTGGCTACATTGGGAAAAACTGTGAGTGCCAGACACAGGGCCGGAGCAGCCAGGAGCTGGAAGGAAGCTGCCGGAAGGACAACAACTCCATCATCTGCTCAGGGCTGGGGGACTGTGTCTGCGGGCAGTGCCTGTGCCACACCAGCGACGTCCCCGGCAAGCTGATATACGGGCAGTACTGCGAGTGTGACACCATCAACTGTGAGCGCTACAACGGCCAGGTCTGCGGCGGCCCGGGGAGGGGGCTCTGCTTCTGCGGGAAGTGCCGCTGCCACCCGGGCTTTGAGGGCTCAGCGTGCCAGTGCGAGAGGACCACTGAGGGCTGCCTGAACCCGCGGCGTGTTGAGTGTAGTGGTCGTGGCCGGTGCCGCTGCAACGTATGCGAGTGCCATTCAGGCTACCAGCTGCCTCTGTGCCAGGAGTGCCCCGGCTGCCCCTCACCCTGTGGCAAGTACATCTCCTGCGCCGAGTGCCTGAAGTTCGAAAAGGGCCCCTTTGGGAAGAACTGCAGCGCGGCGTGTCCGGGCCTGCAGCTGTCGAACAACCCCGTGAAGGGCAGGACCTGCAAGGAGAGGGACTCAGAGGGCTGCTGGGTGGCCTACACGCTGGAGCAGCAGGACGGGATGGACCGCTACCTCATCTATGTGGATGAGAGCCGAGAGTGTGTGGCAGGCCCCAACATCGCCGCCATCGTCGGGGGCACCGTGGCAGGCATCGTGCTGATCGGCATTCTCCTGCTGGTCATCTGGAAGGCTCTGATCCACCTGAGCGACCTCCGGGAGTACAGGCGCTTTGAGAAGGAGAAGCTCAAGTCCCAGTGGAACAATGATAATCCCCTTTTCAAGAGCGCCACCACGACGGTCATGAACCCCAAGTTTGCTGAGAGTTAG

Back to List