Details for gene: MEFV


Interacting selectively and non-covalently with zinc (Zn) ions.


Symbol
MEFV
Name
MEFV innate immuity regulator, pyrin
Entrez ID
4210
Ensembl ID
ENSG00000103313    (more details)
KEGG ID
hsa:4210    (more details)
OMIM ID
608107
Uniprot ID
O15553  
GO ID
hsa:4210    (more details)
Chromosome
16
Strand
-1
Start
3242027
End
3256633
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
NOD-like receptor signaling pathway / The NLRP3 inflammasome / Purinergic signaling in leishmaniasis infection / Yersinia infection /
Sequence
ATGGCTAAGACCCCTAGTGACCATCTGCTGTCCACCCTGGAGGAGCTGGTGCCCTATGACTTCGAGAAGTTCAAGTTCAAGCTGCAGAACACCAGTGTGCAGAAGGAGCACTCCAGGATCCCCCGGAGCCAGATCCAGAGAGCCAGGCCGGTGAAGATGGCCACTCTGCTGGTCACCTACTATGGGGAAGAGTACGCCGTGCAGCTCACCCTGCAGGTCCTGCGGGCCATCAACCAGCGCCTGCTGGCCGAGGAGCTCCACAGGGCAGCCATTCAGGAATATTCCACACAAGAAAACGGCACAGATGATTCCGCAGCGTCCAGCTCCCTGGGGGAGAACAAGCCCAGGAGCCTGAAGACTCCAGACCACCCCGAGGGGAACGAGGGGAACGGCCCTCGGCCGTACGGGGGCGGAGCTGCCAGCCTGCGGTGCAGCCAGCCCGAGGCCGGGAGGGGGCTGTCGAGGAAGCCCCTGAGCAAACGCAGAGAGAAGGCCTCGGAGGGCCTGGACGCGCAGGGCAAGCCTCGGACCCGGAGCCCGGCCCTGCCGGGCGGGAGAAGCCCCGGCCCCTGCAGGGCGCTAGAGGGGGGCCAGGCCGAGGTCCGGCTGCGCAGAAACGCCAGCTCCGCGGGGAGGCTGCAGGGGCTGGCGGGGGGCGCCCCGGGGCAGAAGGAGTGCAGGCCCTTCGAAGTGTACCTGCCCTCGGGAAAGATGCGACCTAGAAGCCTTGAGGTCACCATTTCTACAGGGGAGAAGGCGCCCGCAAATCCAGAAATTCTCCTGACTCTAGAGGAAAAGACAGCTGCGAATCTGGACTCGGCAACAGAACCCCGGGCAAGGCCCACTCCGGATGGAGGGGCATCTGCGGACCTGAAGGAAGGCCCTGGAAATCCAGAACATTCGGTCACCGGAAGGCCACCAGACACGGCTGCGAGTCCCCGCTGCCACGCCCAGGAAGGAGACCCAGTTGACGGTACCTGTGTGCGTGATTCCTGCAGCTTCCCCGAGGCAGTTTCTGGGCACCCCCAGGCCTCAGGCAGCCGCTCACCTGGCTGCCCCCGGTGCCAGGACTCCCATGAAAGGAAGAGCCCGGGAAGCCTAAGCCCCCAGCCCCTGCCACAGTGTAAGCGCCACCTGAAGCAGGTCCAGCTGCTCTTCTGTGAGGATCACGATGAGCCCATCTGCCTCATCTGCAGTCTGAGTCAGGAGCACCAAGGCCACCGGGTGCGCCCCATTGAGGAGGTCGCCCTGGAACACAAGAAGAAAATTCAGAAGCAGCTGGAGCATCTGAAGAAGCTGAGAAAATCAGGGGAGGAGCAGCGATCCTATGGGGAGGAGAAGGCAGTGAGCTTTCTGAAACAAACTGAAGCGCTGAAGCAGCGGGTGCAGAGGAAGCTGGAGCAGGTGTACTACTTCCTGGAGCAGCAAGAGCATTTCTTTGTGGCCTCACTGGAGGACGTGGGCCAGATGGTTGGGCAGATCAGGAAGGCATATGACACCCGCGTATCCCAGGACATCGCCCTGCTCGATGCGCTGATTGGGGAACTGGAGGCCAAGGAGTGCCAGTCAGAATGGGAACTTCTGCAGGACATTGGAGACATCTTGCACAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGTTCCGGAGCTGATTGGCGCTCAGGCACATGCTGTTAATGTGATTCTGGATGCAGAAACCGCTTACCCCAACCTCATCTTCTCTGATGATCTGAAGAGTGTTAGACTTGGAAACAAGTGGGAGAGGCTGCCTGATGGCCCGCAAAGATTTGACAGCTGTATCATTGTTCTGGGCTCTCCGAGTTTCCTCTCTGGCCGCCGTTACTGGGAGGTGGAGGTTGGAGACAAGACAGCATGGATCCTGGGAGCCTGCAAGACATCCATAAGCAGGAAAGGGAACATGACTCTGTCGCCAGAGAATGGCTACTGGGTGGTGATAATGATGAAGGAAAATGAGTACCAGGCGTCCAGCGTTCCCCCGACCCGCCTGCTAATAAAGGAGCCTCCCAAGCGTGTGGGCATCTTCGTGGACTACAGAGTTGGAAGCATCTCCTTTTACAATGTGACAGCCAGATCCCACATCTATACATTCGCCAGCTGCTCTTTCTCTGGGCCCCTTCAACCTATCTTCAGCCCTGGGACACGTGATGGAGGGAAGAACACAGCTCCTCTGACTATCTGTCCAGTGGGTGGTCAGGGGCCTGACTGA

Back to List