Details for gene: TLR4


FALSE


Symbol
TLR4
Name
toll like receptor 4
Entrez ID
7099
Ensembl ID
ENSG00000136869    (more details)
KEGG ID
hsa:7099    (more details)
OMIM ID
603030
Uniprot ID
O00206  
GO ID
hsa:7099    (more details)
Chromosome
9
Strand
1
Start
117704175
End
117724735
miRNA Interactions
hsa-miR-3658 (RPM: 0.0008) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-1304-5p (RPM: 0.1148) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-942-5p (RPM: 2.297) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-4738-3p (RPM: 0.3144) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-4659a-3p (RPM: 0.0502) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-4659b-3p (RPM: 0.0014) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-548g-3p (RPM: 0.003) / hsa-miR-21-5p (RPM: 5494.851) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-136-3p (RPM: 178.2682) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-4742-3p (RPM: 0.5414) / hsa-miR-338-5p (RPM: 16.892) / hsa-miR-526b-5p (RPM: 0.2456) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-630 (RPM: 0.0014) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-4523 (RPM: 0.1094) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-1468-3p (RPM: 0.0042) / hsa-miR-181b-2-3p (RPM: 1.8444) /
Involved Diseases
Behcet's disease (BD) / Age-related macular degeneration (AMD) /
Involved Pathways
PI3K-Akt signaling pathway / Salmonella infection / Inflammatory bowel disease (IBD) / NF-kappa B signaling pathway / Shigellosis / Pathogenic Escherichia coli infection / HIF-1 signaling pathway / Proteoglycans in cancer / Rheumatoid arthritis / Chagas disease (American trypanosomiasis) / Pertussis / Legionellosis / Toxoplasmosis / Amoebiasis / Tuberculosis / Hepatitis B / Measles / Influenza A / Malaria / Phagosome / Leishmaniasis / Toll-like receptor signaling pathway / NOD-like receptor signaling pathway / Toll Like Receptor 4 (TLR4) Cascade / MyD88-independent TLR4 cascade / Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon / ER-Phagosome pathway / Heme signaling / Regulation of TLR by endogenous ligand / Ligand-dependent caspase activation / MyD88:MAL(TIRAP) cascade initiated on plasma membrane / TRIF-mediated programmed cell death / MyD88 deficiency (TLR2/4) / IRAK4 deficiency (TLR2/4) / IKK complex recruitment mediated by RIP1 / TRAF6-mediated induction of TAK1 complex within TLR4 complex / IRAK2 mediated activation of TAK1 complex upon TLR7/8 or 9 stimulation / Lipid and atherosclerosis / Necroptosis / Alcoholic liver disease / Human immunodeficiency virus 1 infection / Coronavirus disease - COVID-19 / Yersinia infection / Neutrophil extracellular trap formation / PD-L1 expression and PD-1 checkpoint pathway in cancer /
Sequence
ATGATGTCTGCCTCGCGCCTGGCTGGGACTCTGATCCCAGCCATGGCCTTCCTCTCCTGCGTGAGACCAGAAAGCTGGGAGCCCTGCGTGGAGGTGGTTCCTAATATTACTTATCAATGCATGGAGCTGAATTTCTACAAAATCCCCGACAACCTCCCCTTCTCAACCAAGAACCTGGACCTGAGCTTTAATCCCCTGAGGCATTTAGGCAGCTATAGCTTCTTCAGTTTCCCAGAACTGCAGGTGCTGGATTTATCCAGGTGTGAAATCCAGACAATTGAAGATGGGGCATATCAGAGCCTAAGCCACCTCTCTACCTTAATATTGACAGGAAACCCCATCCAGAGTTTAGCCCTGGGAGCCTTTTCTGGACTATCAAGTTTACAGAAGCTGGTGGCTGTGGAGACAAATCTAGCATCTCTAGAGAACTTCCCCATTGGACATCTCAAAACTTTGAAAGAACTTAATGTGGCTCACAATCTTATCCAATCTTTCAAATTACCTGAGTATTTTTCTAATCTGACCAATCTAGAGCACTTGGACCTTTCCAGCAACAAGATTCAAAGTATTTATTGCACAGACTTGCGGGTTCTACATCAAATGCCCCTACTCAATCTCTCTTTAGACCTGTCCCTGAACCCTATGAACTTTATCCAACCAGGTGCATTTAAAGAAATTAGGCTTCATAAGCTGACTTTAAGAAATAATTTTGATAGTTTAAATGTAATGAAAACTTGTATTCAAGGTCTGGCTGGTTTAGAAGTCCATCGTTTGGTTCTGGGAGAATTTAGAAATGAAGGAAACTTGGAAAAGTTTGACAAATCTGCTCTAGAGGGCCTGTGCAATTTGACCATTGAAGAATTCCGATTAGCATACTTAGACTACTACCTCGATGATATTATTGACTTATTTAATTGTTTGACAAATGTTTCTTCATTTTCCCTGGTGAGTGTGACTATTGAAAGGGTAAAAGACTTTTCTTATAATTTCGGATGGCAACATTTAGAATTAGTTAACTGTAAATTTGGACAGTTTCCCACATTGAAACTCAAATCTCTCAAAAGGCTTACTTTCACTTCCAACAAAGGTGGGAATGCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTGCTGTTCTCAAAGTGATTTTGGGACAACCAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAACTAGAACATCTGGATTTCCAGCATTCCAATTTGAAACAAATGAGTGAGTTTTCAGTATTCCTATCACTCAGAAACCTCATTTACCTTGACATTTCTCATACTCACACCAGAGTTGCTTTCAATGGCATCTTCAATGGCTTGTCCAGTCTCGAAGTCTTGAAAATGGCTGGCAATTCTTTCCAGGAAAACTTCCTTCCAGATATCTTCACAGAGCTGAGAAACTTGACCTTCCTGGACCTCTCTCAGTGTCAACTGGAGCAGTTGTCTCCAACAGCATTTAACTCACTCTCCAGTCTTCAGGTACTAAATATGAGCCACAACAACTTCTTTTCATTGGATACGTTTCCTTATAAGTGTCTGAACTCCCTCCAGGTTCTTGATTACAGTCTCAATCACATAATGACTTCCAAAAAACAGGAACTACAGCATTTTCCAAGTAGTCTAGCTTTCTTAAATCTTACTCAGAATGACTTTGCTTGTACTTGTGAACACCAGAGTTTCCTGCAATGGATCAAGGACCAGAGGCAGCTCTTGGTGGAAGTTGAACGAATGGAATGTGCAACACCTTCAGATAAGCAGGGCATGCCTGTGCTGAGTTTGAATATCACCTGTCAGATGAATAAGACCATCATTGGTGTGTCGGTCCTCAGTGTGCTTGTAGTATCTGTTGTAGCAGTTCTGGTCTATAAGTTCTATTTTCACCTGATGCTTCTTGCTGGCTGCATAAAGTATGGTAGAGGTGAAAACATCTATGATGCCTTTGTTATCTACTCAAGCCAGGATGAGGACTGGGTAAGGAATGAGCTAGTAAAGAATTTAGAAGAAGGGGTGCCTCCATTTCAGCTCTGCCTTCACTACAGAGACTTTATTCCCGGTGTGGCCATTGCTGCCAACATCATCCATGAAGGTTTCCATAAAAGCCGAAAGGTGATTGTTGTGGTGTCCCAGCACTTCATCCAGAGCCGCTGGTGTATCTTTGAATATGAGATTGCTCAGACCTGGCAGTTTCTGAGCAGTCGTGCTGGTATCATCTTCATTGTCCTGCAGAAGGTGGAGAAGACCCTGCTCAGGCAGCAGGTGGAGCTGTACCGCCTTCTCAGCAGGAACACTTACCTGGAGTGGGAGGACAGTGTCCTGGGGCGGCACATCTTCTGGAGACGACTCAGAAAAGCCCTGCTGGATGGTAAATCATGGAATCCAGAAGGAACAGTGGGTACAGGATGCAATTGGCAGGAAGCAACATCTATCTGA

Back to List