Details for gene: KLRC4


A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it.


Symbol
KLRC4
Name
killer cell lectin like receptor C4
Entrez ID
8302
Ensembl ID
ENSG00000183542    (more details)
KEGG ID
hsa:8302    (more details)
OMIM ID
602893
Uniprot ID
O43908  
GO ID
hsa:8302    (more details)
Chromosome
12
Strand
-1
Start
10407384
End
10409757
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Antigen processing and presentation /
Sequence
ATGAATAAACAAAGAGGAACCTACTCAGAAGTGAGTCTGGCCCAGGACCCAAAGAGGCAGCAAAGGAAACTTAAGGGCAATAAAATCTCCATTTCAGGAACCAAACAGGAAATATTCCAAGTAGAATTAAACCTTCAAAATGCTTCTTCGGATCATCAAGGGAATGACAAGACATATCACTGCAAAGGTTTACTGCCACCTCCAGAGAAGCTCACTGCTGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTGTATTGGAGTACTGGAGCAGAACAATTTTTCCCTGAATAGAAGAATGCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAAGAAAGAGTTTGCTGGCCTGTGCTTCGAAGAACTCTGATCTGCTTTCTATAG

Back to List