Details for gene: IL23R


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
IL23R
Name
interleukin 23 receptor
Entrez ID
149233
Ensembl ID
ENSG00000162594    (more details)
KEGG ID
hsa:149233    (more details)
OMIM ID
607562
Uniprot ID
Q5VWK5  
GO ID
hsa:149233    (more details)
Chromosome
1
Strand
1
Start
67138907
End
67259979
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Inflammatory bowel disease (IBD) / Pathways in cancer / Cytokine-cytokine receptor interaction / Jak-STAT signaling pathway / Interleukin-4 and Interleukin-13 signaling / Interleukin-23 signaling / Th17 cell differentiation /
Sequence
ATGAATCAGGTCACTATTCAATGGGATGCAGTAATAGCCCTTTACATACTCTTCAGCTGGTGTCATGGAGGAATTACAAATATAAACTGCTCTGGCCACATCTGGGTAGAACCAGCCACAATTTTTAAGATGGGTATGAATATCTCTATATATTGCCAAGCAGCAATTAAGAACTGCCAACCAAGGAAACTTCATTTTTATAAAAATGGCATCAAAGAAAGATTTCAAATCACAAGGATTAATAAAACAACAGCTCGGCTTTGGTATAAAAACTTTCTGGAACCACATGCTTCTATGTACTGCACTGCTGAATGTCCCAAACATTTTCAAGAGACACTGATATGTGGAAAAGACATTTCTTCTGGATATCCGCCAGATATTCCTGATGAAGTAACCTGTGTCATTTATGAATATTCAGGCAACATGACTTGCACCTGGAATGCTGGGAAGCTCACCTACATAGACACAAAATACGTGGTACATGTGAAGAGTTTAGAGACAGAAGAAGAGCAACAGTATCTCACCTCAAGCTATATTAACATCTCCACTGATTCATTACAAGGTGGCAAGAAGTACTTGGTTTGGGTCCAAGCAGCAAACGCACTAGGCATGGAAGAGTCAAAACAACTGCAAATTCACCTGGATGATATAGTGATACCTTCTGCAGCCGTCATTTCCAGGGCTGAGACTATAAATGCTACAGTGCCCAAGACCATAATTTATTGGGATAGTCAAACAACAATTGAAAAGGTTTCCTGTGAAATGAGATACAAGGCTACAACAAACCAAACTTGGAATGTTAAAGAATTTGACACCAATTTTACATATGTGCAACAGTCAGAATTCTACTTGGAGCCAAACATTAAGTACGTATTTCAAGTGAGATGTCAAGAAACAGGCAAAAGGTACTGGCAGCCTTGGAGTTCACTGTTTTTTCATAAAACACCTGAAACAGTTCCCCAGGTCACATCAAAAGCATTCCAACATGACACATGGAATTCTGGGCTAACAGTTGCTTCCATCTCTACAGGGCACCTTACTTCTGACAACAGAGGAGACATTGGACTTTTATTGGGAATGATCGTCTTTGCTGTTATGTTGTCAATTCTTTCTTTGATTGGGATATTTAACAGATCATTCCGAACTGGGATTAAAAGAAGGATCTTATTGTTAATACCAAAGTGGCTTTATGAAGATATTCCTAATATGAAAAACAGCAATGTTGTGAAAATGCTACAGGAAAATAGTGAACTTATGAATAATAATTCCAGTGAGCAGGTCCTATATGTTGATCCCATGATTACAGAGATAAAAGAAATCTTCATCCCAGAACACAAGCCTACAGACTACAAGAAGGAGAATACAGGACCCCTGGAGACAAGAGACTACCCGCAAAACTCGCTATTCGACAATACTACAGTTGTATATATTCCTGATCTCAACACTGGATATAAACCCCAAATTTCAAATTTTCTGCCTGAGGGAAGCCATCTCAGCAATAATAATGAAATTACTTCCTTAACACTTAAACCACCAGTTGATTCCTTAGACTCAGGAAATAATCCCAGGTTACAAAAGCATCCTAATTTTGCTTTTTCTGTTTCAAGTGTGAATTCACTAAGCAACACAATATTTCTTGGAGAATTAAGCCTCATATTAAATCAAGGAGAATGCAGTTCTCCTGACATACAAAACTCAGTAGAGGAGGAAACCACCATGCTTTTGGAAAATGATTCACCCAGTGAAACTATTCCAGAACAGACCCTGCTTCCTGATGAATTTGTCTCCTGTTTGGGGATCGTGAATGAGGAGTTGCCATCTATTAATACTTATTTTCCACAAAATATTTTGGAAAGCCACTTCAATAGGATTTCACTCTTGGAAAAGTAG

Back to List