Details for gene: UBAC2


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
UBAC2
Name
UBA domain containing 2
Entrez ID
337867
Ensembl ID
ENSG00000134882    (more details)
KEGG ID
hsa:337867    (more details)
OMIM ID
FALSE
Uniprot ID
Q8NBM4  
GO ID
hsa:337867    (more details)
Chromosome
13
Strand
1
Start
99200774
End
99386504
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Sequence
ATGTTCACCAGCACCGGCTCCAGTGGGCTCTACAAGGCGCCTCTGTCGAAGAGCCTTCTGCTGGTCCCCAGTGCCCTCTCCCTCCTGCTCGCCCTCCTCCTGCCTCACTGCCAGAAGCTCTTTGTGTATGACCTTCACGCAGTCAAGAACGACTTCCAGATTTGGAGGTTGATATGTGGAAGAATAATTTGCCTTGATTTGAAAGATACTTTCTGCAGTAGTCTGCTTATTTATAATTTTAGGATATTTGAAAGAAGATATGGAAGCAGAAAATTTGCATCCTTTTTGCTGGGTTCCTGGGTTTTGTCAGCCTTATTTGACTTTCTCCTCATTGAAGCTATGCAGTATTTCTTTGGCATCACTGCAGCTAGTAATTTGCCTTCTGGATTCCTGGCACCTGTGTTTGCTCTGTTTGTACCATTTTACTGCTCCATACCAAGAGTCCAAGTGGCACAAATTCTGGGTCCGTTGTCCATCACAAACAAGACATTGATTTATATATTGGGACTGCAGCTTTTCACCTCTGGTTCCTACATCTGGATTGTAGCCATAAGTGGACTTATGTCCGGTCTGTGCTACGACAGCAAAATGTTCCAGGTGCATCAGGTGCTCTGCATCCCCAGCTGGATGGCAAAATTCTTTTCTTGGACACTTGAACCCATCTTCTCTTCTTCAGAACCCACCAGCGAAGCCAGAATTGGGATGGGAGCCACGCTGGACATCCAGAGACAGCAGAGAATGGAGCTGCTGGACCGGCAGCTGATGTTCTCTCAGTTTGCACAAGGGAGGCGACAGAGACAGCAGCAGGGAGGAATGATCAATTGGAATCGTCTTTTTCCTCCTTTACGTCAGCGACAAAACGTAAACTATCAGGGCGGTCGGCAGTCTGAGCCAGCAGCGCCCCCTCTAGAAGTTTCTGAGGAACAGGTCGCCCGGCTCATGGAGATGGGATTTTCCAGAGGTGATGCTTTGGAAGCCCTGAGAGCTTCAAACAATGACCTCAATGTCGCCACCAACTTCCTGCTGCAGCACTGA

Back to List