Details for gene: IL12RB2


Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules).


Symbol
IL12RB2
Name
interleukin 12 receptor subunit beta 2
Entrez ID
3595
Ensembl ID
ENSG00000081985    (more details)
KEGG ID
hsa:3595    (more details)
OMIM ID
601642
Uniprot ID
Q99665  
GO ID
hsa:3595    (more details)
Chromosome
1
Strand
1
Start
67307364
End
67398724
miRNA Interactions
Involved Diseases
Behcet's disease (BD) /
Involved Pathways
Inflammatory bowel disease (IBD) / Pathways in cancer / Cytokine-cytokine receptor interaction / Jak-STAT signaling pathway / Interleukin-12 signaling / Interleukin-35 Signalling / Th1 and Th2 cell differentiation /
Sequence
ATGGCACATACTTTTAGAGGATGCTCATTGGCATTTATGTTTATAATCACGTGGCTGTTGATTAAAGCAAAAATAGATGCGTGCAAGAGAGGCGATGTGACTGTGAAGCCTTCCCATGTAATTTTACTTGGATCCACTGTCAATATTACATGCTCTTTGAAGCCCAGACAAGGCTGCTTTCACTATTCCAGACGTAACAAGTTAATCCTGTACAAGTTTGACAGAAGAATCAATTTTCACCATGGCCACTCCCTCAATTCTCAAGTCACAGGTCTTCCCCTTGGTACAACCTTGTTTGTCTGCAAACTGGCCTGTATCAATAGTGATGAAATTCAAATATGTGGAGCAGAGATCTTCGTTGGTGTTGCTCCAGAACAGCCTCAAAATTTATCCTGCATACAGAAGGGAGAACAGGGGACTGTGGCCTGCACCTGGGAAAGAGGACGAGACACCCACTTATACACTGAGTATACTCTACAGCTAAGTGGACCAAAAAATTTAACCTGGCAGAAGCAATGTAAAGACATTTATTGTGACTATTTGGACTTTGGAATCAACCTCACCCCTGAATCACCTGAATCCAATTTCACAGCCAAGGTTACTGCTGTCAATAGTCTTGGAAGCTCCTCTTCACTTCCATCCACATTCACATTCTTGGACATAGTGAGGCCTCTTCCTCCGTGGGACATTAGAATCAAATTTCAAAAGGCTTCTGTGAGCAGATGTACCCTTTATTGGAGAGATGAGGGACTGGTACTGCTTAATCGACTCAGATATCGGCCCAGTAACAGCAGGCTCTGGAATATGGTTAATGTTACAAAGGCCAAAGGAAGACATGATTTGCTGGATCTGAAACCATTTACAGAATATGAATTTCAGATTTCCTCTAAGCTACATCTTTATAAGGGAAGTTGGAGTGATTGGAGTGAATCATTGAGAGCACAAACACCAGAAGAAGAGCCTACTGGGATGTTAGATGTCTGGTACATGAAACGGCACATTGACTACAGTAGACAACAGATTTCTCTTTTCTGGAAGAATCTGAGTGTCTCAGAGGCAAGAGGAAAAATTCTCCACTATCAGGTGACCTTGCAGGAGCTGACAGGAGGGAAAGCCATGACACAGAACATCACAGGACACACCTCCTGGACCACAGTCATTCCTAGAACCGGAAATTGGGCTGTGGCTGTGTCTGCAGCAAATTCAAAAGGCAGTTCTCTGCCCACTCGTATTAACATAATGAACCTGTGTGAGGCAGGGTTGCTGGCTCCTCGCCAGGTCTCTGCAAACTCAGAGGGCATGGACAACATTCTGGTGACTTGGCAGCCTCCCAGGAAAGATCCCTCTGCTGTTCAGGAGTACGTGGTGGAATGGAGAGAGCTCCATCCAGGGGGTGACACACAGGTCCCTCTAAACTGGCTACGGAGTCGACCCTACAATGTGTCTGCTCTGATTTCAGAGAACATAAAATCCTACATCTGTTATGAAATCCGTGTGTATGCACTCTCAGGGGATCAAGGAGGATGCAGCTCCATCCTGGGTAACTCTAAGCACAAAGCACCACTGAGTGGCCCCCACATTAATGCCATCACAGAGGAAAAGGGGAGCATTTTAATTTCATGGAACAGCATTCCAGTCCAGGAGCAAATGGGCTGCCTCCTCCATTATAGGATATACTGGAAGGAACGGGACTCCAACTCCCAGCCTCAGCTCTGTGAAATTCCCTACAGAGTCTCCCAAAATTCACATCCAATAAACAGCCTGCAGCCCCGAGTGACATATGTCCTGTGGATGACAGCTCTGACAGCTGCTGGTGAAAGTTCCCACGGAAATGAGAGGGAATTTTGTCTGCAAGGTAAAGCCAATTGGATGGCGTTTGTGGCACCAAGCATTTGCATTGCTATCATCATGGTGGGCATTTTCTCAACGCATTACTTCCAGCAAAAGGTGTTTGTTCTCCTAGCAGCCCTCAGACCTCAGTGGTGTAGCAGAGAAATTCCAGATCCAGCAAATAGCACTTGCGCTAAGAAATATCCCATTGCAGAGGAGAAGACACAGCTGCCCTTGGACAGGCTCCTGATAGACTGGCCCACGCCTGAAGATCCTGAACCGCTGGTCATCAGTGAAGTCCTTCATCAAGTGACCCCAGTTTTCAGACATCCCCCCTGCTCCAACTGGCCACAAAGGGAAAAAGGAATCCAAGGTCATCAGGCCTCTGAGAAAGACATGATGCACAGTGCCTCAAGCCCACCACCTCCAAGAGCTCTCCAAGCTGAGAGCAGACAACTGGTGGATCTGTACAAGGTGCTGGAGAGCAGGGGCTCCGACCCAAAGCCCGAAAACCCAGCCTGTCCCTGGACGGTGCTCCCAGCAGGTGACCTTCCCACCCATGATGGCTACTTACCCTCCAACATAGATGACCTCCCCTCACATGAGGCACCTCTCGCTGACTCTCTGGAAGAACTGGAGCCTCAGCACATCTCCCTTTCTGTTTTCCCCTCAAGTTCTCTTCACCCACTCACCTTCTCCTGTGGTGATAAGCTGACTCTGGATCAGTTAAAGATGAGGTGTGACTCCCTCATGCTCTGA

Back to List