Details for gene: ABCA4


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; lipid transport : The directed movement of lipids into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Lipids are compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; ABC-type transporter activity : Primary active transporter characterized by two nucleotide-binding domains and two transmembrane domains. Uses the energy generated from ATP hydrolysis to drive the transport of a substance across a membrane. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; cytoplasmic vesicle : A vesicle found in the cytoplasm of a cell. ; GTPase activity : Catalysis of the reaction: GTP + H2O = GDP + phosphate. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; ATPase : A molecular function characterized by the use of ATP hydrolysis as an energy source, for example to catalyze a reaction or drive transport against a concentration gradient. ; ATPase-coupled intramembrane lipid transporter activity : Catalysis of the movement of lipids from one membrane leaflet to the other, using energy from the hydrolysis of ATP. This includes flippases and floppases. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; ATPase-coupled transmembrane transporter activity : Primary active transporter of a solute across a membrane, via the reaction: ATP + H2O = ADP + phosphate, to directly drive the transport of a substance across a membrane. The transport protein may be transiently phosphorylated (P-type transporters), or not (ABC-type transporters and other families of transporters). Primary active transport occurs up the solute's concentration gradient and is driven by a primary energy source. ; retinoid binding : Interacting selectively and non-covalently with retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; retinol transport : The directed movement of retinol into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Retinol is vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. ; lipid transporter activity : Enables the directed movement of lipids into, out of or within a cell, or between cells. ; transporter activity : Enables the directed movement of substances (such as macromolecules, small molecules, ions) into, out of or within a cell, or between cells. ; phospholipid translocation : The movement of a phospholipid molecule from one leaflet of a membrane bilayer to the opposite leaflet. ; photoreceptor disc membrane : Stack of disc membranes located inside a photoreceptor outer segment, and containing densely packed molecules of photoreceptor proteins that traverse the lipid bilayer. Disc membranes arise as evaginations of the ciliary membrane during the development of the outer segment and may or may not remain contiguous with the ciliary membrane. ; 11-cis retinal binding : Interacting selectively and non-covalently with 11-cis retinal, an isomer of retinal that plays an important role in the visual process in most vertebrates. 11-cis retinal combines with opsin in the rods (scotopsin) to form rhodopsin or visual purple. Retinal is one of the three compounds that makes up vitamin A. ; phototransduction, visible light : The sequence of reactions within a cell required to convert absorbed photons from visible light into a molecular signal. A visible light stimulus is electromagnetic radiation that can be perceived visually by an organism; for organisms lacking a visual system, this can be defined as light with a wavelength within the range 380 to 780 nm. ; phosphatidylethanolamine flippase activity : Catalysis of the movement of phosphatidylethanolamine from the exoplasmic to the cytosolic leaftlet of a membrane, using energy from the hydrolysis of ATP. ; all-trans retinal binding : Interacting selectively and non-covalently with all-trans retinal, a compound that plays an important role in the visual process in most vertebrates. All-trans retinal (trans r., visual yellow) results from the bleaching of rhodopsin by light, in which the 11-cis form is converted to the all-trans form. Retinal is one of the forms of vitamin A. ; phospholipid transporter activity : Enables the directed movement of phospholipids into, out of or within a cell, or between cells. Phospholipids are a class of lipids containing phosphoric acid as a mono- or diester. ; retinal metabolic process : The chemical reactions and pathways involving retinal, a compound that plays an important role in the visual process in most vertebrates. In the retina, retinal combines with opsins to form visual pigments. Retinal is one of the forms of vitamin A. ; retinol transmembrane transporter activity : Enables the transfer of retinol from one side of a membrane to the other. Retinol is vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. ; flippase activity : Catalysis of the movement of lipids from the exoplasmic to the cytosolic leaftlet of a membrane, using energy from the hydrolysis of ATP. ; N-retinylidene-phosphatidylethanolamine flippase activity : Catalysis of the movement of N-retinylidene-N-retinylphosphatidylethanolamine from the exoplasmic to the cytosolic leaftlet of a membrane, using energy from the hydrolysis of ATP. ; phospholipid transfer to membrane : The transfer of a phospholipid from its site of synthesis to the plasma membrane. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; rod photoreceptor disc membrane : Stack of disc membranes located inside a rod photoreceptor outer segment, and containing densely packed molecules of rhodopsin photoreceptor proteins that traverse the lipid bilayer. It is thought that rod disc membranes arise as evaginations of the ciliary membrane near the base of the outer segment, which then become completely separated from the ciliary membrane, during the development of the rod outer segment.


Symbol
ABCA4
Name
ATP binding cassette subfamily A member 4
Entrez ID
24
Ensembl ID
ENSG00000198691    (more details)
KEGG ID
hsa:24    (more details)
OMIM ID
153800
Uniprot ID
P78363  
GO ID
hsa:24    (more details)
Chromosome
1
Strand
-1
Start
93992834
End
94121148
miRNA Interactions
hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
ABC transporters /
Sequence
ATGGGCTTCGTGAGACAGATACAGCTTTTGCTCTGGAAGAACTGGACCCTGCGGAAAAGGCAAAAGATTCGCTTTGTGGTGGAACTCGTGTGGCCTTTATCTTTATTTCTGGTCTTGATCTGGTTAAGGAATGCCAACCCACTCTACAGCCATCATGAATGCCATTTCCCCAACAAGGCGATGCCCTCAGCAGGAATGCTGCCGTGGCTCCAGGGGATCTTCTGCAATGTGAACAATCCCTGTTTTCAAAGCCCCACCCCAGGAGAATCTCCTGGAATTGTGTCAAACTATAACAACTCCATCTTGGCAAGGGTATATCGAGATTTTCAAGAACTCCTCATGAATGCACCAGAGAGCCAGCACCTTGGCCGTATTTGGACAGAGCTACACATCTTGTCCCAATTCATGGACACCCTCCGGACTCACCCGGAGAGAATTGCAGGAAGAGGAATACGAATAAGGGATATCTTGAAAGATGAAGAAACACTGACACTATTTCTCATTAAAAACATCGGCCTGTCTGACTCAGTGGTCTACCTTCTGATCAACTCTCAAGTCCGTCCAGAGCAGTTCGCTCATGGAGTCCCGGACCTGGCGCTGAAGGACATCGCCTGCAGCGAGGCCCTCCTGGAGCGCTTCATCATCTTCAGCCAGAGACGCGGGGCAAAGACGGTGCGCTATGCCCTGTGCTCCCTCTCCCAGGGCACCCTACAGTGGATAGAAGACACTCTGTATGCCAACGTGGACTTCTTCAAGCTCTTCCGTGTGCTTCCCACACTCCTAGACAGCCGTTCTCAAGGTATCAATCTGAGATCTTGGGGAGGAATATTATCTGATATGTCACCAAGAATTCAAGAGTTTATCCATCGGCCGAGTATGCAGGACTTGCTGTGGGTGACCAGGCCCCTCATGCAGAATGGTGGTCCAGAGACCTTTACAAAGCTGATGGGCATCCTGTCTGACCTCCTGTGTGGCTACCCCGAGGGAGGTGGCTCTCGGGTGCTCTCCTTCAACTGGTATGAAGACAATAACTATAAGGCCTTTCTGGGGATTGACTCCACAAGGAAGGATCCTATCTATTCTTATGACAGAAGAACAACATCCTTTTGTAATGCATTGATCCAGAGCCTGGAGTCAAATCCTTTAACCAAAATCGCTTGGAGGGCGGCAAAGCCTTTGCTGATGGGAAAAATCCTGTACACTCCTGATTCACCTGCAGCACGAAGGATACTGAAGAATGCCAACTCAACTTTTGAAGAACTGGAACACGTTAGGAAGTTGGTCAAAGCCTGGGAAGAAGTAGGGCCCCAGATCTGGTACTTCTTTGACAACAGCACACAGATGAACATGATCAGAGATACCCTGGGGAACCCAACAGTAAAAGACTTTTTGAATAGGCAGCTTGGTGAAGAAGGTATTACTGCTGAAGCCATCCTAAACTTCCTCTACAAGGGCCCTCGGGAAAGCCAGGCTGACGACATGGCCAACTTCGACTGGAGGGACATATTTAACATCACTGATCGCACCCTCCGCCTGGTCAATCAATACCTGGAGTGCTTGGTCCTGGATAAGTTTGAAAGCTACAATGATGAAACTCAGCTCACCCAACGTGCCCTCTCTCTACTGGAGGAAAACATGTTCTGGGCCGGAGTGGTATTCCCTGACATGTATCCCTGGACCAGCTCTCTACCACCCCACGTGAAGTATAAGATCCGAATGGACATAGACGTGGTGGAGAAAACCAATAAGATTAAAGACAGGTATTGGGATTCTGGTCCCAGAGCTGATCCCGTGGAAGATTTCCGGTACATCTGGGGCGGGTTTGCCTATCTGCAGGACATGGTTGAACAGGGGATCACAAGGAGCCAGGTGCAGGCGGAGGCTCCAGTTGGAATCTACCTCCAGCAGATGCCCTACCCCTGCTTCGTGGACGATTCTTTCATGATCATCCTGAACCGCTGTTTCCCTATCTTCATGGTGCTGGCATGGATCTACTCTGTCTCCATGACTGTGAAGAGCATCGTCTTGGAGAAGGAGTTGCGACTGAAGGAGACCTTGAAAAATCAGGGTGTCTCCAATGCAGTGATTTGGTGTACCTGGTTCCTGGACAGCTTCTCCATCATGTCGATGAGCATCTTCCTCCTGACGATATTCATCATGCATGGAAGAATCCTACATTACAGCGACCCATTCATCCTCTTCCTGTTCTTGTTGGCTTTCTCCACTGCCACCATCATGCTGTGCTTTCTGCTCAGCACCTTCTTCTCCAAGGCCAGTCTGGCAGCAGCCTGTAGTGGTGTCATCTATTTCACCCTCTACCTGCCACACATCCTGTGCTTCGCCTGGCAGGACCGCATGACCGCTGAGCTGAAGAAGGCTGTGAGCTTACTGTCTCCGGTGGCATTTGGATTTGGCACTGAGTACCTGGTTCGCTTTGAAGAGCAAGGCCTGGGGCTGCAGTGGAGCAACATCGGGAACAGTCCCACGGAAGGGGACGAATTCAGCTTCCTGCTGTCCATGCAGATGATGCTCCTTGATGCTGCTGTCTATGGCTTACTCGCTTGGTACCTTGATCAGGTGTTTCCAGGAGACTATGGAACCCCACTTCCTTGGTACTTTCTTCTACAAGAGTCGTATTGGCTTGGCGGTGAAGGGTGTTCAACCAGAGAAGAAAGAGCCCTGGAAAAGACCGAGCCCCTAACAGAGGAAACGGAGGATCCAGAGCACCCAGAAGGAATACACGACTCCTTCTTTGAACGTGAGCATCCAGGGTGGGTTCCTGGGGTATGCGTGAAGAATCTGGTAAAGATTTTTGAGCCCTGTGGCCGGCCAGCTGTGGACCGTCTGAACATCACCTTCTACGAGAACCAGATCACCGCATTCCTGGGCCACAATGGAGCTGGGAAAACCACCACCTTGTCCATCCTGACGGGTCTGTTGCCACCAACCTCTGGGACTGTGCTCGTTGGGGGAAGGGACATTGAAACCAGCCTGGATGCAGTCCGGCAGAGCCTTGGCATGTGTCCACAGCACAACATCCTGTTCCACCACCTCACGGTGGCTGAGCACATGCTGTTCTATGCCCAGCTGAAAGGAAAGTCCCAGGAGGAGGCCCAGCTGGAGATGGAAGCCATGTTGGAGGACACAGGCCTCCACCACAAGCGGAATGAAGAGGCTCAGGACCTATCAGGTGGCATGCAGAGAAAGCTGTCGGTTGCCATTGCCTTTGTGGGAGATGCCAAGGTGGTGATTCTGGACGAACCCACCTCTGGGGTGGACCCTTACTCGAGACGCTCAATCTGGGATCTGCTCCTGAAGTATCGCTCAGGCAGAACCATCATCATGTCCACTCACCACATGGACGAGGCCGACCTCCTTGGGGACCGCATTGCCATCATTGCCCAGGGAAGGCTCTACTGCTCAGGCACCCCACTCTTCCTGAAGAACTGCTTTGGCACAGGCTTGTACTTAACCTTGGTGCGCAAGATGAAAAACATCCAGAGCCAAAGGAAAGGCAGTGAGGGGACCTGCAGCTGCTCGTCTAAGGGTTTCTCCACCACGTGTCCAGCCCACGTCGATGACCTAACTCCAGAACAAGTCCTGGATGGGGATGTAAATGAGCTGATGGATGTAGTTCTCCACCATGTTCCAGAGGCAAAGCTGGTGGAGTGCATTGGTCAAGAACTTATCTTCCTTCTTCCAAATAAGAACTTCAAGCACAGAGCATATGCCAGCCTTTTCAGAGAGCTGGAGGAGACGCTGGCTGACCTTGGTCTCAGCAGTTTTGGAATTTCTGACACTCCCCTGGAAGAGATTTTTCTGAAGGTCACGGAGGATTCTGATTCAGGACCTCTGTTTGCGGGTGGCGCTCAGCAGAAAAGAGAAAACGTCAACCCCCGACACCCCTGCTTGGGTCCCAGAGAGAAGGCTGGACAGACACCCCAGGACTCCAATGTCTGCTCCCCAGGGGCGCCGGCTGCTCACCCAGAGGGCCAGCCTCCCCCAGAGCCAGAGTGCCCAGGCCCGCAGCTCAACACGGGGACACAGCTGGTCCTCCAGCATGTGCAGGCGCTGCTGGTCAAGAGATTCCAACACACCATCCGCAGCCACAAGGACTTCCTGGCGCAGATCGTGCTCCCGGCTACCTTTGTGTTTTTGGCTCTGATGCTTTCTATTGTTATCCCTCCTTTTGGCGAATACCCCGCTTTGACCCTTCACCCCTGGATATATGGGCAGCAGTACACCTTCTTCAGCATGGATGAACCAGGCAGTGAGCAGTTCACGGTACTTGCAGACGTCCTCCTGAATAAGCCAGGCTTTGGCAACCGCTGCCTGAAGGAAGGGTGGCTTCCGGAGTACCCCTGTGGCAACTCAACACCCTGGAAGACTCCTTCTGTGTCCCCAAACATCACCCAGCTGTTCCAGAAGCAGAAATGGACACAGGTCAACCCTTCACCATCCTGCAGGTGCAGCACCAGGGAGAAGCTCACCATGCTGCCAGAGTGCCCCGAGGGTGCCGGGGGCCTCCCGCCCCCCCAGAGAACACAGCGCAGCACGGAAATTCTACAAGACCTGACGGACAGGAACATCTCCGACTTCTTGGTAAAAACGTATCCTGCTCTTATAAGAAGCAGCTTAAAGAGCAAATTCTGGGTCAATGAACAGAGGTATGGAGGAATTTCCATTGGAGGAAAGCTCCCAGTCGTCCCCATCACGGGGGAAGCACTTGTTGGGTTTTTAAGCGACCTTGGCCGGATCATGAATGTGAGCGGGGGCCCTATCACTAGAGAGGCCTCTAAAGAAATACCTGATTTCCTTAAACATCTAGAAACTGAAGACAACATTAAGGTGTGGTTTAATAACAAAGGCTGGCATGCCCTGGTCAGCTTTCTCAATGTGGCCCACAACGCCATCTTACGGGCCAGCCTGCCTAAGGACAGGAGCCCCGAGGAGTATGGAATCACCGTCATTAGCCAACCCCTGAACCTGACCAAGGAGCAGCTCTCAGAGATTACAGTGCTGACCACTTCAGTGGATGCTGTGGTTGCCATCTGCGTGATTTTCTCCATGTCCTTCGTCCCAGCCAGCTTTGTCCTTTATTTGATCCAGGAGCGGGTGAACAAATCCAAGCACCTCCAGTTTATCAGTGGAGTGAGCCCCACCACCTACTGGGTGACCAACTTCCTCTGGGACATCATGAATTATTCCGTGAGTGCTGGGCTGGTGGTGGGCATCTTCATCGGGTTTCAGAAGAAAGCCTACACTTCTCCAGAAAACCTTCCTGCCCTTGTGGCACTGCTCCTGCTGTATGGATGGGCGGTCATTCCCATGATGTACCCAGCATCCTTCCTGTTTGATGTCCCCAGCACAGCCTATGTGGCTTTATCTTGTGCTAATCTGTTCATCGGCATCAACAGCAGTGCTATTACCTTCATCTTGGAATTATTTGAGAATAACCGGACGCTGCTCAGGTTCAACGCCGTGCTGAGGAAGCTGCTCATTGTCTTCCCCCACTTCTGCCTGGGCCGGGGCCTCATTGACCTTGCACTGAGCCAGGCTGTGACAGATGTCTATGCCCGGTTTGGTGAGGAGCACTCTGCAAATCCGTTCCACTGGGACCTGATTGGGAAGAACCTGTTTGCCATGGTGGTGGAAGGGGTGGTGTACTTCCTCCTGACCCTGCTGGTCCAGCGCCACTTCTTCCTCTCCCAATGGATTGCCGAGCCCACTAAGGAGCCCATTGTTGATGAAGATGATGATGTGGCTGAAGAAAGACAAAGAATTATTACTGGTGGAAATAAAACTGACATCTTAAGGCTACATGAACTAACCAAGATTTATCCAGGCACCTCCAGCCCAGCAGTGGACAGGCTGTGTGTCGGAGTTCGCCCTGGAGAGTGCTTTGGCCTCCTGGGAGTGAATGGTGCCGGCAAAACAACCACATTCAAGATGCTCACTGGGGACACCACAGTGACCTCAGGGGATGCCACCGTAGCAGGCAAGAGTATTTTAACCAATATTTCTGAAGTCCATCAAAATATGGGCTACTGTCCTCAGTTTGATGCAATTGATGAGCTGCTCACAGGACGAGAACATCTTTACCTTTATGCCCGGCTTCGAGGTGTACCAGCAGAAGAAATCGAAAAGGTTGCAAACTGGAGTATTAAGAGCCTGGGCCTGACTGTCTACGCCGACTGCCTGGCTGGCACGTACAGTGGGGGCAACAAGCGGAAACTCTCCACAGCCATCGCACTCATTGGCTGCCCACCGCTGGTGCTGCTGGATGAGCCCACCACAGGGATGGACCCCCAGGCACGCCGCATGCTGTGGAACGTCATCGTGAGCATCATCAGAGAAGGGAGGGCTGTGGTCCTCACATCCCACAGCATGGAAGAATGTGAGGCACTGTGTACCCGGCTGGCCATCATGGTAAAGGGCGCCTTTCGATGTATGGGCACCATTCAGCATCTCAAGTCCAAATTTGGAGATGGCTATATCGTCACAATGAAGATCAAATCCCCGAAGGACGACCTGCTTCCTGACCTGAACCCTGTGGAGCAGTTCTTCCAGGGGAACTTCCCAGGCAGTGTGCAGAGGGAGAGGCACTACAACATGCTCCAGTTCCAGGTCTCCTCCTCCTCCCTGGCGAGGATCTTCCAGCTCCTCCTCTCCCACAAGGACAGCCTGCTCATCGAGGAGTACTCAGTCACACAGACCACACTGGACCAGGTGTTTGTAAATTTTGCTAAACAGCAGACTGAAAGTCATGACCTCCCTCTGCACCCTCGAGCTGCTGGAGCCAGTCGACAAGCCCAGGACTGA

Back to List