Details for gene: CFB


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; serine-type endopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; complement activation : Any process involved in the activation of any of the steps of the complement cascade, which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes; the initial steps of complement activation involve one of three pathways, the classical pathway, the alternative pathway, and the lectin pathway, all of which lead to the terminal complement pathway. ; peptidase activity : Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid. ; proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; complement activation, alternative pathway : Any process involved in the activation of any of the steps of the alternative pathway of the complement cascade which allows for the direct killing of microbes and the regulation of other immune processes. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; serine-type peptidase activity : Catalysis of the hydrolysis of peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; complement binding : Interacting selectively and non-covalently with any component or product of the complement cascade. ;


Symbol
CFB
Name
complement factor B
Entrez ID
629
Ensembl ID
ENSG00000243649    (more details)
KEGG ID
hsa:629    (more details)
OMIM ID
138470
Uniprot ID
A0A1U9X7H8  
GO ID
hsa:629    (more details)
Chromosome
10
Strand
1
Start
122454653
End
122457352
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-194-5p (RPM: 48.9448) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-210-5p (RPM: 134.815) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Staphylococcus aureus infection / Complement and coagulation cascades /
Sequence
ATGGGGAGCAATCTCAGCCCCCAACTCTGCCTGATGCCCTTTATCTTGGGCCTCTTGTCTGGAGGTGTGACCACCACTCCATGGTCTTTGGCCCGGCCCCAGGGATCCTGCTCTCTGGAGGGGGTAGAGATCAAAGGCGGCTCCTTCCGACTTCTCCAAGAGGGCCAGGCACTGGAGTACGTGTGTCCTTCTGGCTTCTACCCGTACCCTGTGCAGACACGTACCTGCAGATCTACGGGGTCCTGGAGCACCCTGAAGACTCAAGACCAAAAGACTGTCAGGAAGGCAGAGTGCAGAGCAATCCACTGTCCAAGACCACACGACTTCGAGAACGGGGAATACTGGCCCCGGTCTCCCTACTACAATGTGAGTGATGAGATCTCTTTCCACTGCTATGACGGTTACACTCTCCGGGGCTCTGCCAATCGCACCTGCCAAGTGAATGGCCGATGGAGTGGGCAGACAGCGATCTGTGACAACGGAGCGGGGTACTGCTCCAACCCGGGCATCCCCATTGGCACAAGGAAGGTGGGCAGCCAGTACCGCCTTGAAGACAGCGTCACCTACCACTGCAGCCGGGGGCTTACCCTGCGTGGCTCCCAGCGGCGAACGTGTCAGGAAGGTGGCTCTTGGAGCGGGACGGAGCCTTCCTGCCAAGACTCCTTCATGTACGACACCCCTCAAGAGGTGGCCGAAGCTTTCCTGTCTTCCCTGACAGAGACCATAGAAGGAGTCGATGCTGAGGATGGGCACGGCCCAGGGGAACAACAGAAGCGGAAGATCGTCCTGGACCCTTCAGGCTCCATGAACATCTACCTGGTGCTAGATGGATCAGACAGCATTGGGGCCAGCAACTTCACAGGAGCCAAAAAGTGTCTAGTCAACTTAATTGAGAAGGTGGCAAGTTATGGTGTGAAGCCAAGATATGGTCTAGTGACATATGCCACATACCCCAAAATTTGGGTCAAAGTGTCTGAAGCAGACAGCAGTAATGCAGACTGGGTCACGAAGCAGCTCAATGAAATCAATTATGAAGACCACAAGTTGAAGTCAGGGACTAACACCAAGAAGGCCCTCCAGGCAGTGTACAGCATGATGAGCTGGCCAGATGACGTCCCTCCTGAAGGCTGGAACCGCACCCGCCATGTCATCATCCTCATGACTGATGGATTGCACAACATGGGCGGGGACCCAATTACTGTCATTGATGAGATCCGGGACTTGCTATACATTGGCAAGGATCGCAAAAACCCAAGGGAGGATTATCTGGATGTCTATGTGTTTGGGGTCGGGCCTTTGGTGAACCAAGTGAACATCAATGCTTTGGCTTCCAAGAAAGACAATGAGCAACATGTGTTCAAAGTCAAGGATATGGAAAACCTGGAAGATGTTTTCTACCAAATGATCGATGAAAGCCAGTCTCTGAGTCTCTGTGGCATGGTTTGGGAACACAGGAAGGGTACCGATTACCACAAGCAACCATGGCAGGCCAAGATCTCAGTCATTCGCCCTTCAAAGGGACACGAGAGCTGTATGGGGGCTGTGGTGTCTGAGTACTTTGTGCTGACAGCAGCACATTGTTTCACTGTGGATGACAAGGAACACTCAATCAAGGTCAGCGTAGGAGGGGAGAAGCGGGACCTGGAGATAGAAGTAGTCCTATTTCACCCCAACTACAACATTAATGGGAAAAAAGAAGCAGGAATTCCTGAATTTTATGACTATGACGTTGCCCTGATCAAGCTCAAGAATAAGCTGAAATATGGCCAGACTATCAGGCCCATTTGTCTCCCCTGCACCGAGGGAACAACTCGAGCTTTGAGGCTTCCTCCAACTACCACTTGCCAGCAACAAAAGGAAGAGCTGCTCCCTGCACAGGATATCAAAGCTCTGTTTGTGTCTGAGGAGGAGAAAAAGCTGACTCGGAAGGAGGTCTACATCAAGAATGGGGATAAGAAAGGCAGCTGTGAGAGAGATGCTCAATATGCCCCAGGCTATGACAAAGTCAAGGACATCTCAGAGGTGGTCACCCCTCGGTTCCTTTGTACTGGAGGAGTGAGTCCCTATGCTGACCCCAATACTTGCAGAGGTGATTCTGGCGGCCCCTTGATAGTTCACAAGAGAAGTCGTTTCATTCAAGTTGGTGTAATCAGCTGGGGAGTAGTGGATGTCTGCAAAAACCAGAAGCGGCAAAAGCAGGTACCTGCTCACGCCCGAGACTTTCACATCAACCTCTTTCAAGTGCTGCCCTGGCTGAAGGAGAAACTCCAAGATGAGGATTTGGGTTTTCTATAA

Back to List