Details for gene: C3


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; inflammatory response : The immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. The process is characterized by local vasodilation, extravasation of plasma into intercellular spaces and accumulation of white blood cells and macrophages. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; endopeptidase inhibitor activity : Binds to and stops, prevents or reduces the activity of an endopeptidase, any enzyme that hydrolyzes nonterminal peptide bonds in polypeptides. ; complement activation : Any process involved in the activation of any of the steps of the complement cascade, which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes; the initial steps of complement activation involve one of three pathways, the classical pathway, the alternative pathway, and the lectin pathway, all of which lead to the terminal complement pathway. ; negative regulation of endopeptidase activity : Any process that decreases the frequency, rate or extent of endopeptidase activity, the endohydrolysis of peptide bonds within proteins. ; lipid metabolic process : The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids. ; fatty acid metabolic process : The chemical reactions and pathways involving fatty acids, aliphatic monocarboxylic acids liberated from naturally occurring fats and oils by hydrolysis. ; positive regulation of protein phosphorylation : Any process that activates or increases the frequency, rate or extent of addition of phosphate groups to amino acids within a protein. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; immune response : Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; complement activation, alternative pathway : Any process involved in the activation of any of the steps of the alternative pathway of the complement cascade which allows for the direct killing of microbes and the regulation of other immune processes. ; complement activation, classical pathway : Any process involved in the activation of any of the steps of the classical pathway of the complement cascade which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; G protein-coupled receptor signaling pathway : A series of molecular signals that proceeds with an activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. The GTP-bound activated alpha-G-protein then dissociates from the beta- and gamma-subunits to further transmit the signal within the cell. The pathway begins with receptor-ligand interaction, or for basal GPCR signaling the pathway begins with the receptor activating its G protein in the absence of an agonist, and ends with regulation of a downstream cellular process, e.g. transcription. The pathway can start from the plasma membrane, Golgi or nuclear membrane. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; secretory granule lumen : The volume enclosed by the membrane of a secretory granule. ; signaling receptor binding : Interacting selectively and non-covalently with one or more specific sites on a receptor molecule, a macromolecule that undergoes combination with a hormone, neurotransmitter, drug or intracellular messenger to initiate a change in cell function. ; endoplasmic reticulum lumen : The volume enclosed by the membranes of the endoplasmic reticulum. ; azurophil granule lumen : The volume enclosed by the membrane of an azurophil granule, a primary lysosomal granule found in neutrophil granulocytes that contains a wide range of hydrolytic enzymes and is released into the extracellular fluid. ; C5L2 anaphylatoxin chemotactic receptor binding : Interacting selectively and non-covalently with a C5L2 anaphylatoxin chemotactic receptor. ; positive regulation of type IIa hypersensitivity : Any process that activates or increases the frequency, rate or extent of type IIa hypersensitivity, a type of inflammatory response. ; positive regulation of activation of membrane attack complex : Any process that activates, maintains or increases the frequency, rate or extent of the activation of the membrane attack complex components of the complement cascade. ; response to bacterium : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus from a bacterium. ; positive regulation of vascular endothelial growth factor production : Any process that increases or activates the frequency, rate, or extent of production of vascular endothelial growth factor. ; positive regulation of glucose transmembrane transport : Any process that increases the frequency, rate or extent of glucose transport across a membrane. Glucose transport is the directed movement of the hexose monosaccharide glucose into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; regulation of triglyceride biosynthetic process : Any process that modulates the rate, frequency, or extent of triglyceride biosynthesis. Triglyceride biosynthesis is the collection of chemical reactions and pathways resulting in the formation of triglyceride, any triester of glycerol. ; positive regulation of lipid storage : Any process that increases the rate, frequency or extent of lipid storage. Lipid storage is the accumulation and maintenance in cells or tissues of lipids, compounds soluble in organic solvents but insoluble or sparingly soluble in aqueous solvents. Lipid reserves can be accumulated during early developmental stages for mobilization and utilization at later stages of development. ; neuron remodeling : The developmentally regulated remodeling of neuronal projections such as pruning to eliminate the extra dendrites and axons projections set up in early stages of nervous system development. ; oviduct epithelium development : The progression of the oviduct epithelium over time from its initial formation to the mature structure. An oviduct is a tube through which an ova passes from the ovary to the uterus, or from the ovary to the outside of the organism. The oviduct epithelium is the specialized epithelium that lines the oviduct. ; positive regulation of G protein-coupled receptor signaling pathway : Any process that activates or increases the frequency, rate or extent of G protein-coupled receptor signaling pathway activity. ; positive regulation of angiogenesis : Any process that activates or increases angiogenesis. ; positive regulation of receptor-mediated endocytosis : Any process that activates or increases the frequency, rate or extent of receptor mediated endocytosis, the uptake of external materials by cells, utilizing receptors to ensure specificity of transport. ; positive regulation of phagocytosis : Any process that activates or increases the frequency, rate or extent of phagocytosis. ; positive regulation of phagocytosis, engulfment : Any process that activates or increases the frequency, rate or extent of the internalization of bacteria, immune complexes and other particulate matter or of an apoptotic cell by phagocytosis. ; amyloid-beta clearance : The process in which amyloid-beta is removed from extracellular brain regions by mechanisms involving cell surface receptors. ; complement-dependent cytotoxicity : Cell killing caused by the membrane attack complex formed following complement activation. ; complement-mediated synapse pruning : Synaptic pruning mediated by complement system signalling. ; vertebrate eye-specific patterning : Early postnatal vertebrate developmental process, during which axons of retinal ganglion cells (RGCs), transmitting overlapping inputs from both eyes, segregate into distinct eye-specific non-overlapping regions in the dorsal lateral geniculate nucleus (dLGN) of the thalamus. ; cell surface receptor signaling pathway involved in cell-cell signaling : Any cell surface receptor signaling pathway that is involved in cell-cell signaling. ; positive regulation of apoptotic cell clearance : Any process that activates or increases the frequency, rate or extent of apoptotic cell clearance. ; cell surface : The external part of the cell wall and/or plasma membrane. ; protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ; : ;


Symbol
C3
Name
complement C3
Entrez ID
718
Ensembl ID
ENSG00000125730    (more details)
KEGG ID
hsa:718    (more details)
OMIM ID
120700
Uniprot ID
B4DR57  
GO ID
hsa:718    (more details)
Chromosome
6
Strand
-1
Start
31897785
End
31945672
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-216a-5p (RPM: 20.4176) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-1297 (RPM: 0.0024) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-5001-3p (RPM: 0.622) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-4649-3p (RPM: 0.0112) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-1827 (RPM: 0.03) / hsa-miR-4722-5p (RPM: 0.0332) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-3065-3p (RPM: 17.8542) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-219b-3p (RPM: 0.1282) / hsa-miR-3135b (RPM: 0.0038) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-4635 (RPM: 0.0156) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-589-3p (RPM: 1.3938) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-940 (RPM: 4.614) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-4522 (RPM: 0.0706) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-199b-3p (RPM: 360.8262) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-199a-3p (RPM: 731.3038) / hsa-miR-3192-5p (RPM: 0.1056) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-514b-5p (RPM: 0.0618) / hsa-miR-365a-5p (RPM: 0.6394) / hsa-miR-890 (RPM: 0.1328) / hsa-miR-3929 (RPM: 0.0406) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-4768-3p (RPM: 0.002) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-4438 (RPM: 0.0032) / hsa-miR-642b-3p (RPM: 0.0292) / hsa-miR-665 (RPM: 0.445) / hsa-miR-216b-5p (RPM: 11.7092) / hsa-miR-365b-5p (RPM: 1.3016) / hsa-miR-1306-5p (RPM: 5.6804) / hsa-miR-513c-5p (RPM: 0.9144) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-25-5p (RPM: 6.4806) / hsa-miR-5697 (RPM: 0.0726) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-658 (RPM: 0.0012) / hsa-miR-4478 (RPM: 0.0594) / hsa-miR-562 (RPM: 0.002) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-320e (RPM: 0.223) / hsa-miR-550b-2-5p (RPM: 0.0036) / hsa-miR-1227-3p (RPM: 0.046) / hsa-miR-3199 (RPM: 0.1412) / hsa-miR-4638-5p (RPM: 0.0318) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-1307-3p (RPM: 130.8454) / hsa-miR-4649-5p (RPM: 0.0842) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-6720-5p (RPM: 0.0746) / hsa-miR-3928-5p (RPM: 0.2808) / hsa-miR-6806-3p (RPM: 0.0878) / hsa-miR-6849-3p (RPM: 0.0148) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-939-3p (RPM: 0.04) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-7151-3p (RPM: 0.0092) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-7703 (RPM: 0.3104) / hsa-miR-6787-3p (RPM: 0.1544) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-7843-3p (RPM: 0.002) / hsa-miR-504-3p (RPM: 0.16) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6851-5p (RPM: 0.0318) / hsa-miR-7847-3p (RPM: 0.0118) / hsa-miR-6808-5p (RPM: 0.0032) / hsa-miR-6877-3p (RPM: 0.1494) / hsa-miR-6819-3p (RPM: 0.0696) / hsa-miR-6884-5p (RPM: 0.168) / hsa-miR-6893-5p (RPM: 0.0066) / hsa-miR-6729-5p (RPM: 0.0606) / hsa-miR-6741-3p (RPM: 0.6252) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Chagas disease (American trypanosomiasis) / Pertussis / Legionellosis / Herpes simplex infection / Complement and coagulation cascades / Phagosome /
Sequence
ATGGGACCCACCTCAGGTCCCAGCCTGCTGCTCCTGCTACTAACCCACCTCCCCCTGGCTCTGGGGAGTCCCATGTACTCTATCATCACCCCCAACATCTTGCGGCTGGAGAGCGAGGAGACCATGGTGCTGGAGGCCCACGACGCGCAAGGGGATGTTCCAGTCACTGTTACTGTCCACGACTTCCCAGGCAAAAAACTAGTGCTGTCCAGTGAGAAGACTGTGCTGACCCCTGCCACCAACCACATGGGCAACGTCACCTTCACGATCCCAGCCAACAGGGAGTTCAAGTCAGAAAAGGGGCGCAACAAGTTCGTGACCGTGCAGGCCACCTTCGGGACCCAAGTGGTGGAGAAGGTGGTGCTGGTCAGCCTGCAGAGCGGGTACCTCTTCATCCAGACAGACAAGACCATCTACACCCCTGGCTCCACAGTTCTCTATCGGATCTTCACCGTCAACCACAAGCTGCTACCCGTGGGCCGGACGGTCATGGTCAACATTGAGAACCCGGAAGGCATCCCGGTCAAGCAGGACTCCTTGTCTTCTCAGAACCAGCTTGGCGTCTTGCCCTTGTCTTGGGACATTCCGGAACTCGTCAACATGGGCCAGTGGAAGATCCGAGCCTACTATGAAAACTCACCACAGCAGGTCTTCTCCACTGAGTTTGAGGTGAAGGAGTACGTGCTGCCCAGTTTCGAGGTCATAGTGGAGCCTACAGAGAAATTCTACTACATCTATAACGAGAAGGGCCTGGAGGTCACCATCACCGCCAGGTTCCTCTACGGGAAGAAAGTGGAGGGAACTGCCTTTGTCATCTTCGGGATCCAGGATGGCGAACAGAGGATTTCCCTGCCTGAATCCCTCAAGCGCATTCCGATTGAGGATGGCTCGGGGGAGGTTGTGCTGAGCCGGAAGGTACTGCTGGACGGGGTGCAGAACCCCCGAGCAGAAGACCTGGTGGGGAAGTCTTTGTACGTGTCTGCCACCGTCATCTTGCACTCAGGCAGTGACATGGTGCAGGCAGAGCGCAGCGGGATCCCCATCGTGACCTCTCCCTACCAGATCCACTTCACCAAGACACCCAAGTACTTCAAACCAGGAATGCCCTTTGACCTCATGGTGTTCGTGACGAACCCTGATGGCTCTCCAGCCTACCGAGTCCCCGTGGCAGTCCAGGGCGAGGACACTGTGCAGTCTCTAACCCAGGGAGATGGCGTGGCCAAACTCAGCATCAACACACACCCCAGCCAGAAGCCCTTGAGCATCACGGTGCGCACGAAGAAGCAGGAGCTCTCGGAGGCAGAGCAGGCTACCAGGACCATGCAGGCTCTGCCCTACAGCACCGTGGGCAACTCCAACAATTACCTGCATCTCTCAGTGCTACGTACAGAGCTCAGACCCGGGGAGACCCTCAACGTCAACTTCCTCCTGCGAATGGACCGCGCCCACGAGGCCAAGATCCGCTACTACACCTACCTGATCATGAACAAGGGCAGGCTGTTGAAGGCGGGACGCCAGGTGCGAGAGCCCGGCCAGGACCTGGTGGTGCTGCCCCTGTCCATCACCACCGACTTCATCCCTTCCTTCCGCCTGGTGGCGTACTACACGCTGATCGGTGCCAGCGGCCAGAGGGAGGTGGTGGCCGACTCCGTGTGGGTGGACGTCAAGGACTCCTGCGTGGGCTCGCTGGTGGTAAAAAGCGGCCAGTCAGAAGACCGGCAGCCTGTACCTGGGCAGCAGATGACCCTGAAGATAGAGGGTGACCACGGGGCCCGGGTGGTACTGGTGGCCGTGGACAAGGGCGTGTTCGTGCTGAATAAGAAGAACAAACTGACGCAGAGTAAGATCTGGGACGTGGTGGAGAAGGCAGACATCGGCTGCACCCCGGGCAGTGGGAAGGATTACGCCGGTGTCTTCTCCGACGCAGGGCTGACCTTCACGAGCAGCAGTGGCCAGCAGACCGCCCAGAGGGCAGAACTTCAGTGCCCGCAGCCAGCCGCCCGCCGACGCCGTTCCGTGCAGCTCACGGAGAAGCGAATGGACAAAGTCGGCAAGTACCCCAAGGAGCTGCGCAAGTGCTGCGAGGACGGCATGCGGGAGAACCCCATGAGGTTCTCGTGCCAGCGCCGGACCCGTTTCATCTCCCTGGGCGAGGCGTGCAAGAAGGTCTTCCTGGACTGCTGCAACTACATCACAGAGCTGCGGCGGCAGCACGCGCGGGCCAGCCACCTGGGCCTGGCCAGGAGTAACCTGGATGAGGACATCATTGCAGAAGAGAACATCGTTTCCCGAAGTGAGTTCCCAGAGAGCTGGCTGTGGAACGTTGAGGACTTGAAAGAGCCACCGAAAAATGGAATCTCTACGAAGCTCATGAATATATTTTTGAAAGACTCCATCACCACGTGGGAGATTCTGGCTGTGAGCATGTCGGACAAGAAAGGGATCTGTGTGGCAGACCCCTTCGAGGTCACAGTAATGCAGGACTTCTTCATCGACCTGCGGCTACCCTACTCTGTTGTTCGAAACGAGCAGGTGGAAATCCGAGCCGTTCTCTACAATTACCGGCAGAACCAAGAGCTCAAGGTGAGGGTGGAACTACTCCACAATCCAGCCTTCTGCAGCCTGGCCACCACCAAGAGGCGTCACCAGCAGACCGTAACCATCCCCCCCAAGTCCTCGTTGTCCGTTCCATATGTCATCGTGCCGCTAAAGACCGGCCTGCAGGAAGTGGAAGTCAAGGCTGCTGTCTACCATCATTTCATCAGTGACGGTGTCAGGAAGTCCCTGAAGGTCGTGCCGGAAGGAATCAGAATGAACAAAACTGTGGCTGTTCGCACCCTGGATCCAGAACGCCTGGGCCGTGAAGGAGTGCAGAAAGAGGACATCCCACCTGCAGACCTCAGTGACCAAGTCCCGGACACCGAGTCTGAGACCAGAATTCTCCTGCAAGGGACCCCAGTGGCCCAGATGACAGAGGATGCCGTCGACGCGGAACGGCTGAAGCACCTCATTGTGACCCCCTCGGGCTGCGGGGAACAGAACATGATCGGCATGACGCCCACGGTCATCGCTGTGCATTACCTGGATGAAACGGAGCAGTGGGAGAAGTTCGGCCTAGAGAAGCGGCAGGGGGCCTTGGAGCTCATCAAGAAGGGGTACACCCAGCAGCTGGCCTTCAGACAACCCAGCTCTGCCTTTGCGGCCTTCGTGAAACGGGCACCCAGCACCTGGCTGACCGCCTACGTGGTCAAGGTCTTCTCTCTGGCTGTCAACCTCATCGCCATCGACTCCCAAGTCCTCTGCGGGGCTGTTAAATGGCTGATCCTGGAGAAGCAGAAGCCCGACGGGGTCTTCCAGGAGGATGCGCCCGTGATACACCAAGAAATGATTGGTGGATTACGGAACAACAACGAGAAAGACATGGCCCTCACGGCCTTTGTTCTCATCTCGCTGCAGGAGGCTAAAGATATTTGCGAGGAGCAGGTCAACAGCCTGCCAGGCAGCATCACTAAAGCAGGAGACTTCCTTGAAGCCAACTACATGAACCTACAGAGATCCTACACTGTGGCCATTGCTGGCTATGCTCTGGCCCAGATGGGCAGGCTGAAGGGGCCTCTTCTTAACAAATTTCTGACCACAGCCAAAGATAAGAACCGCTGGGAGGACCCTGGTAAGCAGCTCTACAACGTGGAGGCCACATCCTATGCCCTCTTGGCCCTACTGCAGCTAAAAGACTTTGACTTTGTGCCTCCCGTCGTGCGTTGGCTCAATGAACAGAGATACTACGGTGGTGGCTATGGCTCTACCCAGGCCACCTTCATGGTGTTCCAAGCCTTGGCTCAATACCAAAAGGACGCCCCTGACCACCAGGAACTGAACCTTGATGTGTCCCTCCAACTGCCCAGCCGCAGCTCCAAGATCACCCACCGTATCCACTGGGAATCTGCCAGCCTCCTGCGATCAGAAGAGACCAAGGAAAATGAGGGTTTCACAGTCACAGCTGAAGGAAAAGGCCAAGGCACCTTGTCGGTGGTGACAATGTACCATGCTAAGGCCAAAGATCAACTCACCTGTAATAAATTCGACCTCAAGGTCACCATAAAACCAGCACCGGAAACAGAAAAGAGGCCTCAGGATGCCAAGAACACTATGATCCTTGAGATCTGTACCAGGTACCGGGGAGACCAGGATGCCACTATGTCTATATTGGACATATCCATGATGACTGGCTTTGCTCCAGACACAGATGACCTGAAGCAGCTGGCCAATGGTGTTGACAGATACATCTCCAAGTATGAGCTGGACAAAGCCTTCTCCGATAGGAACACCCTCATCATCTACCTGGACAAGGTCTCACACTCTGAGGATGACTGTCTAGCTTTCAAAGTTCACCAATACTTTAATGTAGAGCTTATCCAGCCTGGAGCAGTCAAGGTCTACGCCTATTACAACCTGGAGGAAAGCTGTACCCGGTTCTACCATCCGGAAAAGGAGGATGGAAAGCTGAACAAGCTCTGCCGTGATGAACTGTGCCGCTGTGCTGAGGAGAATTGCTTCATACAAAAGTCGGATGACAAGGTCACCCTGGAAGAACGGCTGGACAAGGCCTGTGAGCCAGGAGTGGACTATGTGTACAAGACCCGACTGGTCAAGGTTCAGCTGTCCAATGACTTTGACGAGTACATCATGGCCATTGAGCAGACCATCAAGTCAGGCTCGGATGAGGTGCAGGTTGGACAGCAGCGCACGTTCATCAGCCCCATCAAGTGCAGAGAAGCCCTGAAGCTGGAGGAGAAGAAACACTACCTCATGTGGGGTCTCTCCTCCGATTTCTGGGGAGAGAAGCCCAACCTCAGCTACATCATCGGGAAGGACACTTGGGTGGAGCACTGGCCCGAGGAGGACGAATGCCAAGACGAAGAGAACCAGAAACAATGCCAGGACCTCGGCGCCTTCACCGAGAGCATGGTTGTCTTTGGGTGCCCCAACTGA

Back to List