Details for gene: C9


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; immune response : Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat. ; membrane attack complex : A protein complex produced by sequentially activated components of the complement cascade inserted into a target cell membrane and forming a pore leading to cell lysis via ion and water flow. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; cytolysis : The rupture of cell membranes and the loss of cytoplasm. ; complement activation, alternative pathway : Any process involved in the activation of any of the steps of the alternative pathway of the complement cascade which allows for the direct killing of microbes and the regulation of other immune processes. ; complement activation, classical pathway : Any process involved in the activation of any of the steps of the classical pathway of the complement cascade which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; protein homooligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of identical component monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; cell killing : Any process in an organism that results in the killing of its own cells or those of another organism, including in some cases the death of the other organism. Killing here refers to the induction of death in one cell by another cell, not cell-autonomous death due to internal or other environmental conditions. ;


Symbol
C9
Name
complement C9
Entrez ID
735
Ensembl ID
ENSG00000113600    (more details)
KEGG ID
hsa:735    (more details)
OMIM ID
120940
Uniprot ID
P02748  
GO ID
hsa:735    (more details)
Chromosome
19
Strand
-1
Start
6677704
End
6730562
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Prion diseases / Amoebiasis / Systemic lupus erythematosus / Complement and coagulation cascades /
Sequence
ATGTCAGCCTGCCGGAGCTTTGCAGTTGCAATCTGCATTTTAGAAATAAGCATCCTCACAGCACAGTACACGACCAGTTATGACCCAGAGCTAACAGAAAGCAGTGGCTCTGCATCACACATAGACTGCAGAATGAGCCCCTGGAGTGAATGGTCACAATGCGATCCTTGTCTCAGACAAATGTTTCGTTCAAGAAGCATTGAGGTCTTTGGACAATTTAATGGGAAAAGATGCACCGACGCTGTGGGAGACAGACGACAGTGTGTGCCCACAGAGCCCTGTGAGGATGCTGAGGATGACTGCGGAAATGACTTTCAATGCAGTACAGGCAGATGCATAAAGATGCGACTTCGGTGTAATGGTGACAATGACTGCGGAGACTTTTCAGATGAGGATGATTGTGAAAGTGAGCCCCGTCCCCCCTGCAGAGACAGAGTGGTAGAAGAGTCTGAGCTGGCACGAACAGCAGGCTATGGGATCAACATTTTAGGGATGGATCCCCTAAGCACACCTTTTGACAATGAGTTCTACAATGGACTCTGTAACCGGGATCGGGATGGAAACACTCTGACATACTACCGAAGACCTTGGAACGTGGCTTCTTTGATCTATGAAACCAAAGGCGAGAAAAATTTCAGAACCGAACATTACGAAGAACAAATTGAAGCATTTAAAAGTATCATCCAAGAGAAGACATCAAATTTTAATGCAGCTATATCTCTAAAATTTACACCCACTGAAACAAATAAAGCTGAACAATGTTGTGAGGAAACAGCCTCCTCAATTTCTTTACATGGCAAGGGTAGTTTTCGGTTTTCATATTCCAAAAATGAAACTTACCAACTATTTTTGTCATATTCTTCAAAGAAGGAAAAAATGTTTCTGCATGTGAAAGGAGAAATTCATCTGGGAAGATTTGTAATGAGAAATCGCGATGTTGTGCTCACAACAACTTTTGTGGATGATATAAAAGCTTTGCCAACTACCTATGAAAAGGGAGAATATTTTGCCTTTTTGGAAACCTATGGAACTCACTACAGTAGCTCTGGGTCTCTAGGAGGACTCTATGAACTAATATATGTTTTGGATAAAGCTTCCATGAAGCGGAAAGGTGTTGAACTAAAAGACATAAAGAGATGCCTTGGGTATCATCTGGATGTATCTCTGGCTTTCTCTGAAATCTCTGTTGGAGCTGAATTTAATAAAGATGATTGTGTAAAGAGGGGAGAGGGTAGAGCTGTAAACATCACCAGTGAAAACCTCATAGATGATGTTGTTTCACTCATAAGAGGTGGAACCAGAAAATATGCATTTGAACTGAAAGAAAAGCTTCTCCGAGGAACCGTGATTGATGTGACTGACTTTGTCAACTGGGCCTCTTCCATAAATGATGCTCCTGTTCTCATTAGTCAAAAACTGTCTCCTATATATAATCTGGTTCCAGTGAAAATGAAAAATGCACACCTAAAGAAACAAAACTTGGAAAGAGCCATTGAAGACTATATCAATGAATTTAGTGTAAGAAAATGCCACACATGCCAAAATGGAGGTACAGTGATTCTAATGGATGGAAAGTGTTTGTGTGCCTGCCCATTCAAATTTGAGGGAATTGCCTGTGAAATCAGTAAACAAAAAATTTCTGAAGGATTGCCAGCCCTAGAGTTCCCCAATGAAAAATAG

Back to List