Details for gene: CFH


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; complement activation, alternative pathway : Any process involved in the activation of any of the steps of the alternative pathway of the complement cascade which allows for the direct killing of microbes and the regulation of other immune processes. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; heparin binding : Interacting selectively and non-covalently with heparin, any member of a group of glycosaminoglycans found mainly as an intracellular component of mast cells and which consist predominantly of alternating alpha-(1->4)-linked D-galactose and N-acetyl-D-glucosamine-6-sulfate residues. ; complement activation : Any process involved in the activation of any of the steps of the complement cascade, which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes; the initial steps of complement activation involve one of three pathways, the classical pathway, the alternative pathway, and the lectin pathway, all of which lead to the terminal complement pathway. ; regulation of complement activation : Any process that modulates the frequency, rate or extent of complement activation. ; regulation of complement-dependent cytotoxicity : Any process that modulates the frequency, rate or extent of complement-dependent cytotoxicity. ; heparan sulfate proteoglycan binding : Interacting selectively and non-covalently with a heparan sulfate proteoglycan, any proteoglycan containing heparan sulfate as the glycosaminoglycan carbohydrate unit. ;


Symbol
CFH
Name
complement factor H
Entrez ID
3075
Ensembl ID
ENSG00000000971    (more details)
KEGG ID
hsa:3075    (more details)
OMIM ID
126700
Uniprot ID
A0A024R962  
GO ID
hsa:3075    (more details)
Chromosome
6
Strand
1
Start
31945650
End
31952084
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-548o-3p (RPM: 3.2198) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Signaling pathways regulating pluripotency of stem cells / Maturity onset diabetes of the young / Staphylococcus aureus infection / Complement and coagulation cascades /
Sequence
ATGAGACTTCTAGCAAAGATTATTTGCCTTATGTTATGGGCTATTTGTGTAGCAGAAGATTGCAATGAACTTCCTCCAAGAAGAAATACAGAAATTCTGACAGGTTCCTGGTCTGACCAAACATATCCAGAAGGCACCCAGGCTATCTATAAATGCCGCCCTGGATATAGATCTCTTGGAAATGTAATAATGGTATGCAGGAAGGGAGAATGGGTTGCTCTTAATCCATTAAGGAAATGTCAGAAAAGGCCCTGTGGACATCCTGGAGATACTCCTTTTGGTACTTTTACCCTTACAGGAGGAAATGTGTTTGAATATGGTGTAAAAGCTGTGTATACATGTAATGAGGGGTATCAATTGCTAGGTGAGATTAATTACCGTGAATGTGACACAGATGGATGGACCAATGATATTCCTATATGTGAAGTTGTGAAGTGTTTACCAGTGACAGCACCAGAGAATGGAAAAATTGTCAGTAGTGCAATGGAACCAGATCGGGAATACCATTTTGGACAAGCAGTACGGTTTGTATGTAACTCAGGCTACAAGATTGAAGGAGATGAAGAAATGCATTGTTCAGACGATGGTTTTTGGAGTAAAGAGAAACCAAAGTGTGTGGAAATTTCATGCAAATCCCCAGATGTTATAAATGGATCTCCTATATCTCAGAAGATTATTTATAAGGAGAATGAACGATTTCAATATAAATGTAACATGGGTTATGAATACAGTGAAAGAGGAGATGCTGTATGCACTGAATCTGGATGGCGTCCGTTGCCTTCATGTGAAGAAAAATCATGTGATAATCCTTATATTCCAAATGGTGACTACTCACCTTTAAGGATTAAACACAGAACTGGAGATGAAATCACGTACCAGTGTAGAAATGGTTTTTATCCTGCAACCCGGGGAAATACAGCAAAATGCACAAGTACTGGCTGGATACCTGCTCCGAGATGTACCTTGAAACCTTGTGATTATCCAGACATTAAACATGGAGGTCTATATCATGAGAATATGCGTAGACCATACTTTCCAGTAGCTGTAGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCGTCAGGAAGTTACTGGGATCACATTCATTGCACACAAGATGGATGGTCGCCAGCAGTACCATGCCTCAGAAAATGTTATTTTCCTTATTTGGAAAATGGATATAATCAAAATCATGGAAGAAAGTTTGTACAGGGTAAATCTATAGACGTTGCCTGCCATCCTGGCTACGCTCTTCCAAAAGCGCAGACCACAGTTACATGTATGGAGAATGGCTGGTCTCCTACTCCCAGATGCATCCGTGTCAAAACATGTTCCAAATCAAGTATAGATATTGAGAATGGGTTTATTTCTGAATCTCAGTATACATATGCCTTAAAAGAAAAAGCGAAATATCAATGCAAACTAGGATATGTAACAGCAGATGGTGAAACATCAGGATCAATTACATGTGGGAAAGATGGATGGTCAGCTCAACCCACGTGCATTAAATCTTGTGATATCCCAGTATTTATGAATGCCAGAACTAAAAATGACTTCACATGGTTTAAGCTGAATGACACATTGGACTATGAATGCCATGATGGTTATGAAAGCAATACTGGAAGCACCACTGGTTCCATAGTGTGTGGTTACAATGGTTGGTCTGATTTACCCATATGTTATGAAAGAGAATGCGAACTTCCTAAAATAGATGTACACTTAGTTCCTGATCGCAAGAAAGACCAGTATAAAGTTGGAGAGGTGTTGAAATTCTCCTGCAAACCAGGATTTACAATAGTTGGACCTAATTCCGTTCAGTGCTACCACTTTGGATTGTCTCCTGACCTCCCAATATGTAAAGAGCAAGTACAATCATGTGGTCCACCTCCTGAACTCCTCAATGGGAATGTTAAGGAAAAAACGAAAGAAGAATATGGACACAGTGAAGTGGTGGAATATTATTGCAATCCTAGATTTCTAATGAAGGGACCTAATAAAATTCAATGTGTTGATGGAGAGTGGACAACTTTACCAGTGTGTATTGTGGAGGAGAGTACCTGTGGAGATATACCTGAACTTGAACATGGCTGGGCCCAGCTTTCTTCCCCTCCTTATTACTATGGAGATTCAGTGGAATTCAATTGCTCAGAATCATTTACAATGATTGGACACAGATCAATTACGTGTATTCATGGAGTATGGACCCAACTTCCCCAGTGTGTGGCAATAGATAAACTTAAGAAGTGCAAATCATCAAATTTAATTATACTTGAGGAACATTTAAAAAACAAGAAGGAATTCGATCATAATTCTAACATAAGGTACAGATGTAGAGGAAAAGAAGGATGGATACACACAGTCTGCATAAATGGAAGATGGGATCCAGAAGTGAACTGCTCAATGGCACAAATACAATTATGCCCACCTCCACCTCAGATTCCCAATTCTCACAATATGACAACCACACTGAATTATCGGGATGGAGAAAAAGTATCTGTTCTTTGCCAAGAAAATTATCTAATTCAGGAAGGAGAAGAAATTACATGCAAAGATGGAAGATGGCAGTCAATACCACTCTGTGTTGAAAAAATTCCATGTTCACAACCACCTCAGATAGAACACGGAACCATTAATTCATCCAGGTCTTCACAAGAAAGTTATGCACATGGGACTAAATTGAGTTATACTTGTGAGGGTGGTTTCAGGATATCTGAAGAAAATGAAACAACATGCTACATGGGAAAATGGAGTTCTCCACCTCAGTGTGAAGGCCTTCCTTGTAAATCTCCACCTGAGATTTCTCATGGTGTTGTAGCTCACATGTCAGACAGTTATCAGTATGGAGAAGAAGTTACGTACAAATGTTTTGAAGGTTTTGGAATTGATGGGCCTGCAATTGCAAAATGCTTAGGAGAAAAATGGTCTCACCCTCCATCATGCATAAAAACAGATTGTCTCAGTTTACCTAGCTTTGAAAATGCCATACCCATGGGAGAGAAGAAGGATGTGTATAAGGCGGGTGAGCAAGTGACTTACACTTGTGCAACATATTACAAAATGGATGGAGCCAGTAATGTAACATGCATTAATAGCAGATGGACAGGAAGGCCAACATGCAGAGACACCTCCTGTGTGAATCCGCCCACAGTACAAAATGCTTATATAGTGTCGAGACAGATGAGTAAATATCCATCTGGTGAGAGAGTACGTTATCAATGTAGGAGCCCTTATGAAATGTTTGGGGATGAAGAAGTGATGTGTTTAAATGGAAACTGGACGGAACCACCTCAATGCAAAGATTCTACAGGAAAATGTGGGCCCCCTCCACCTATTGACAATGGGGACATTACTTCATTCCCGTTGTCAGTATATGCTCCAGCTTCATCAGTTGAGTACCAATGCCAGAACTTGTATCAACTTGAGGGTAACAAGCGAATAACATGTAGAAATGGACAATGGTCAGAACCACCAAAATGCTTACATCCGTGTGTAATATCCCGAGAAATTATGGAAAATTATAACATAGCATTAAGGTGGACAGCCAAACAGAAGCTTTATTCGAGAACAGGTGAATCAGTTGAATTTGTGTGTAAACGGGGATATCGTCTTTCATCACGTTCTCACACATTGCGAACAACATGTTGGGATGGGAAACTGGAGTATCCAACTTGTGCAAAAAGATAG

Back to List