Details for gene: CFHR1


protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; negative regulation of protein binding : Any process that stops, prevents, or reduces the frequency, rate or extent of protein binding. ; cytolysis by host of symbiont cells : The killing by an organism of a cell in its symbiont organism by means of the rupture of cell membranes and the loss of cytoplasm. The symbiont is defined as the smaller of the organisms involved in a symbiotic interaction. ; complement activation : Any process involved in the activation of any of the steps of the complement cascade, which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes; the initial steps of complement activation involve one of three pathways, the classical pathway, the alternative pathway, and the lectin pathway, all of which lead to the terminal complement pathway. ;


Symbol
CFHR1
Name
complement factor H related 1
Entrez ID
3078
Ensembl ID
ENSG00000244414    (more details)
KEGG ID
hsa:3078    (more details)
OMIM ID
134371
Uniprot ID
Q03591  
GO ID
hsa:3078    (more details)
Chromosome
1
Strand
1
Start
196652043
End
196747504
miRNA Interactions
hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Sequence
ATGTGGCTCCTGGTCAGTGTAATTCTAATCTCACGGATATCCTCTGTTGGGGGAGAAGCAACATTTTGTGATTTTCCAAAAATAAACCATGGAATTCTATATGATGAAGAAAAATATAAGCCATTTTCCCAGGTTCCTACAGGGGAAGTTTTCTATTACTCCTGTGAATATAATTTTGTGTCTCCTTCAAAATCATTTTGGACTCGCATAACATGCACAGAAGAAGGATGGTCACCAACACCAAAGTGTCTCAGACTGTGTTTCTTTCCTTTTGTGGAAAATGGTCATTCTGAATCTTCAGGACAAACACATCTGGAAGGTGATACTGTGCAAATTATTTGCAACACAGGATACAGACTTCAAAACAATGAGAACAACATTTCATGTGTAGAACGGGGCTGGTCCACCCCTCCCAAATGCAGGTCCACTGACACTTCCTGTGTGAATCCGCCCACAGTACAAAATGCTCATATACTGTCGAGACAGATGAGTAAATATCCATCTGGTGAGAGAGTACGTTATGAATGTAGGAGCCCTTATGAAATGTTTGGGGATGAAGAAGTGATGTGTTTAAATGGAAACTGGACAGAACCACCTCAATGCAAAGATTCTACGGGAAAATGTGGGCCCCCTCCACCTATTGACAATGGGGACATTACTTCATTCCCGTTGTCAGTATATGCTCCAGCTTCATCAGTTGAGTACCAATGCCAGAACTTGTATCAACTTGAGGGTAACAAGCGAATAACATGTAGAAATGGACAATGGTCAGAACCACCAAAATGCTTACATCCGTGTGTAATATCCCGAGAAATTATGGAAAATTATAACATAGCATTAAGGTGGACAGCCAAACAGAAGCTTTATTTGAGAACAGGTGAATCAGCTGAATTTGTGTGTAAACGGGGATATCGTCTTTCATCACGTTCTCACACATTGCGAACAACATGTTGGGATGGGAAACTGGAGTATCCAACTTGTGCAAAAAGATAG

Back to List