Details for gene: HIC1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ; intrinsic apoptotic signaling pathway in response to DNA damage : A series of molecular signals in which an intracellular signal is conveyed to trigger the apoptotic death of a cell. The pathway is induced by the detection of DNA damage, and ends when the execution phase of apoptosis is triggered. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; sequence-specific DNA binding : Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding. ; Wnt signaling pathway : The series of molecular signals initiated by binding of a Wnt protein to a frizzled family receptor on the surface of the target cell and ending with a change in cell state. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; histone deacetylase binding : Interacting selectively and non-covalently with the enzyme histone deacetylase. ; DNA-binding transcription repressor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that represses or decreases the transcription of specific gene sets transcribed by RNA polymerase II. ; sequence-specific double-stranded DNA binding : Interacting selectively and non-covalently with double-stranded DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA, e.g. promotor binding or rDNA binding. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; negative regulation of Wnt signaling pathway : Any process that stops, prevents, or reduces the frequency, rate or extent of the Wnt signaling pathway. ; positive regulation of DNA damage response, signal transduction by p53 class mediator : Any process that activates, maintains or increases the rate of the cascade of processes induced by the cell cycle regulator phosphoprotein p53, or an equivalent protein, in response to the detection of DNA damage. ;


Symbol
HIC1
Name
HIC ZBTB transcriptional repressor 1
Entrez ID
3090
Ensembl ID
ENSG00000177374    (more details)
KEGG ID
hsa:3090    (more details)
OMIM ID
603825
Uniprot ID
Q14526  
GO ID
hsa:3090    (more details)
Chromosome
1
Strand
1
Start
196943738
End
196959622
miRNA Interactions
hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-18a-3p (RPM: 5.394) / hsa-miR-23c (RPM: 1.4294) / hsa-miR-4516 (RPM: 0.4114) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-33b-5p (RPM: 5.2366) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-1913 (RPM: 0.4166) / hsa-miR-3175 (RPM: 0.2046) / hsa-miR-345-5p (RPM: 317.5696) / hsa-miR-4749-5p (RPM: 0.337) / hsa-miR-542-5p (RPM: 0.7876) / hsa-miR-4706 (RPM: 0.1162) / hsa-miR-6777-5p (RPM: 0.557) / hsa-miR-6889-5p (RPM: 0.041) / hsa-miR-4508 (RPM: 0.574) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Sequence
ATGACTTTTCCTGAAGCGGACATTTTACTTAAATCGGGAGAGTGTGCTGGGCAGACGATGCTGGACACGATGGAGGCGCCCGGCCACTCCAGGCAGCTGCTGCTGCAGCTCAACAACCAGCGCACCAAGGGCTTCTTGTGCGACGTGATCATCGTGGTGCAGAACGCCCTCTTCCGCGCGCACAAGAACGTGCTGGCGGCCAGCAGCGCCTACCTCAAGTCCCTGGTGGTGCATGACAACCTGCTCAACCTGGACCATGACATGGTGAGCCCGGCCGTGTTCCGCCTGGTGCTGGACTTCATCTACACCGGCCGCCTGGCTGACGGCGCAGAGGCGGCTGCGGCCGCGGCCGTGGCCCCGGGGGCTGAGCCGAGCCTGGGCGCCGTGCTGGCCGCCGCCAGCTACCTGCAGATCCCCGACCTCGTGGCGCTGTGCAAGAAACGCCTCAAGCGCCACGGCAAGTACTGCCACCTGCGGGGCGGCGGCGGCGGCGGCGGCGGCTACGCGCCCTATGGTCGGCCGGGCCGGGGCCTGCGGGCCGCCACGCCGGTCATCCAGGCCTGCTACCCGTCCCCAGTCGGGCCTCCGCCGCCGCCTGCCGCGGAGCCGCCCTCGGGCCCAGAGGCCGCGGTCAACACGCACTGCGCCGAGCTGTACGCGTCGGGACCCGGCCCGGCCGCCGCACTCTGTGCCTCGGAGCGCCGCTGCTCCCCTCTTTGTGGCCTGGACCTGTCCAAGAAGAGCCCGCCGGGCTCCGCGGCGCCAGAGCGGCCGCTGGCTGAGCGCGAGCTGCCCCCGCGCCCGGACAGCCCTCCCAGCGCCGGCCCCGCCGCCTACAAGGAGCCGCCTCTCGCCCTGCCGTCGCTGCCGCCGCTGCCCTTCCAGAAGCTGGAGGAGGCCGCACCGCCTTCCGACCCATTTCGCGGCGGCAGCGGCAGCCCGGGACCCGAGCCCCCCGGCCGCCCCGACGGGCCTAGTCTCCTCTATCGCTGGATGAAGCACGAGCCGGGCCTGGGTAGCTATGGCGACGAGCTGGGCCGGGAGCGCGGCTCCCCCAGCGAGCGCTGCGAAGAGCGTGGTGGGGACGCGGCCGTCTCGCCCGGGGGGCCCCCGCTCGGCCTGGCGCCGCCGCCGCGCTACCCTGGCAGCCTGGACGGGCCCGGCGCGGGCGGCGACGGCGACGACTACAAGAGCAGCAGCGAGGAGACCGGTAGCAGCGAGGACCCCAGCCCGCCTGGCGGCCACCTCGAGGGCTACCCATGCCCGCACCTGGCCTATGGCGAGCCCGAGAGCTTCGGTGACAACCTGTACGTGTGCATTCCGTGCGGCAAGGGCTTCCCCAGCTCTGAGCAGCTGAACGCGCACGTGGAGGCTCACGTGGAGGAGGAGGAAGCGCTGTACGGCAGGGCCGAGGCGGCCGAAGTGGCCGCTGGGGCCGCCGGCCTAGGGCCCCCTTTTGGAGGCGGCGGGGACAAGGTCGCCGGGGCTCCGGGTGGCCTGGGAGAGCTGCTGCGGCCCTACCGCTGCGCGTCGTGCGACAAGAGCTACAAGGACCCGGCCACGCTGCGGCAGCACGAGAAGACGCACTGGCTGACCCGGCCCTACCCATGCACCATCTGCGGGAAGAAGTTCACGCAGCGTGGGACCATGACGCGCCACATGCGCAGCCACCTGGGCCTCAAGCCCTTCGCGTGCGACGCGTGCGGCATGCGGTTCACGCGCCAGTACCGCCTCACGGAGCACATGCGCATCCACTCGGGCGAGAAGCCCTACGAGTGCCAGGTGTGCGGCGGCAAGTTCGCACAGCAACGCAACCTCATCAGCCACATGAAGATGCACGCCGTGGGGGGCGCGGCCGGCGCGGCCGGGGCGCTGGCGGGCTTGGGGGGGCTCCCCGGCGTCCCCGGCCCCGACGGCAAGGGCAAGCTCGACTTCCCCGAGGGCGTCTTTGCTGTGGCTCGCCTCACGGCCGAGCAGCTGAGCCTGAAGCAGCAGGACAAGGCGGCCGCGGCCGAGCTGCTGGCGCAGACCACGCACTTCCTGCACGACCCCAAGGTGGCGCTGGAGAGCCTCTACCCGCTGGCCAAGTTCACGGCCGAGCTGGGCCTCAGCCCCGACAAGGCGGCCGAGGTGCTGAGCCAGGGCGCTCACCTGGCGGCCGGGCCCGACGGCCGGACCATCGACCGTTTCTCTCCCACCTAG

Back to List