Details for gene: CFI


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; scavenger receptor activity : Combining with any modified low-density lipoprotein (LDL) or other polyanionic ligand and delivering the ligand into the cell via endocytosis. Ligands include acetylated and oxidized LDL, Gram-positive and Gram-negative bacteria, apoptotic cells, amyloid-beta fibrils, and advanced glycation end products (AGEs). ; serine-type endopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; peptidase activity : Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; innate immune response : Innate immune responses are defense responses mediated by germline encoded components that directly recognize components of potential pathogens. ; serine-type peptidase activity : Catalysis of the hydrolysis of peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; endocytosis : A vesicle-mediated transport process in which cells take up external materials or membrane constituents by the invagination of a small region of the plasma membrane to form a new membrane-bounded vesicle. ; complement activation, classical pathway : Any process involved in the activation of any of the steps of the classical pathway of the complement cascade which allows for the direct killing of microbes, the disposal of immune complexes, and the regulation of other immune processes. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ;


Symbol
CFI
Name
complement factor I
Entrez ID
3426
Ensembl ID
ENSG00000205403    (more details)
KEGG ID
hsa:3426    (more details)
OMIM ID
217030
Uniprot ID
A8K3L0  
GO ID
hsa:3426    (more details)
Chromosome
1
Strand
-1
Start
196774813
End
196795407
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Staphylococcus aureus infection / Complement and coagulation cascades /
Sequence
ATGAAGCTTCTTCATGTTTTCCTGTTATTTCTGTGCTTCCACTTAAGGTTTTGCAAGGTCACTTATACATCTCAAGAGGATCTGGTGGAGAAAAAGTGCTTAGCAAAAAAATATACTCACCTCTCCTGCGATAAAGTCTTCTGCCAGCCATGGCAGAGATGCATTGAGGGCACCTGTGTTTGTAAACTACCGTATCAGTGCCCAAAGAATGGCACTGCAGTGTGTGCAACTAACAGGAGAAGCTTCCCAACATACTGTCAACAAAAGAGTTTGGAATGTCTTCATCCAGGGACAAAGTTTTTAAATAACGGAACATGCACAGCCGAAGGAAAGTTTAGTGTTTCCTTGAAGCATGGAAATACAGATTCAGAGGGAATAGTTGAAGTAAAACTTGTGGACCAAGATAAGACAATGTTCATATGCAAAAGCAGCTGGAGCATGAGGGAAGCCAACGTGGCCTGCCTTGACCTTGGGTTTCAACAAGGTGCTGATACTCAAAGAAGGTTTAAGTTGTCTGATCTCTCTATAAATTCCACTGAATGTCTACATGTGCATTGCCGAGGATTAGAGACCAGTTTGGCTGAATGTACTTTTACTAAGAGAAGAACTATGGGTTACCAGGATTTCGCTGATGTGGTTTGTTATACACAGAAAGCAGATTCTCCAATGGATGACTTCTTTCAGTGTGTGAATGGGAAATACATTTCTCAGATGAAAGCCTGTGATGGTATCAATGATTGTGGAGACCAAAGTGATGAACTGTGTTGTAAAGCATGCCAAGGCAAAGGCTTCCATTGCAAATCGGGTGTTTGCATTCCAAGCCAGTATCAATGCAATGGTGAGGTGGACTGCATTACAGGGGAAGATGAAGTTGGCTGTGCAGGCTTTGCATCTGTGACTCAAGAAGAAACAGAAATTTTGACTGCTGACATGGATGCAGAAAGAAGACGGATAAAATCATTATTACCTAAACTATCTTGTGGAGTTAAAAACAGAATGCACATTCGAAGGAAACGAATTGTGGGAGGAAAGCGAGCACAACTGGGAGACCTCCCATGGCAGGTGGCAATTAAGGATGCCAGTGGAATCACCTGTGGGGGAATTTATATTGGTGGCTGTTGGATTCTGACTGCTGCACATTGTCTCAGAGCCAGTAAAACTCATCGTTACCAAATATGGACAACAGTAGTAGACTGGATACACCCCGACCTTAAACGTATAGTAATTGAATACGTGGATAGAATTATTTTCCATGAAAACTACAATGCAGGCACTTACCAAAATGACATCGCTTTGATTGAAATGAAAAAAGACGGAAACAAAAAAGATTGTGAGCTGCCTCGTTCCATCCCTGCCTGTGTCCCCTGGTCTCCTTACCTATTCCAACCTAATGATACATGCATCGTTTCTGGCTGGGGACGAGAAAAAGATAACGAAAGAGTCTTTTCACTTCAGTGGGGTGAAGTTAAACTAATAAGCAACTGCTCTAAGTTTTACGGAAATCGTTTCTATGAAAAAGAAATGGAATGTGCAGGTACATATGATGGTTCCATCGATGCCTGTAAAGGGGACTCTGGAGGCCCCTTAGTCTGTATGGATGCCAACAATGTGACTTATGTCTGGGGTGTTGTGAGTTGGGGGGAAAACTGTGGAAAACCAGAGTTCCCAGGTGTTTACACCAAAGTGGCCAATTATTTTGACTGGATTAGCTACCATGTAGGAAGGCCTTTTATTTCTCAGTACAATGTATAA

Back to List