Details for gene: HTRA1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; serine-type endopeptidase activity : Catalysis of the hydrolysis of internal, alpha-peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; peptidase activity : Catalysis of the hydrolysis of a peptide bond. A peptide bond is a covalent bond formed when the carbon atom from the carboxyl group of one amino acid shares electrons with the nitrogen atom from the amino group of a second amino acid. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; insulin-like growth factor binding : Interacting selectively and non-covalently with an insulin-like growth factor, any member of a group of polypeptides that are structurally homologous to insulin and share many of its biological activities, but are immunologically distinct from it. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; growth factor binding : Interacting selectively and non-covalently with any growth factor, proteins or polypeptides that stimulate a cell or organism to grow or proliferate. ; serine-type peptidase activity : Catalysis of the hydrolysis of peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; collagen-containing extracellular matrix : An extracellular matrix consisting mainly of proteins (especially collagen) and glycosaminoglycans (mostly as proteoglycans) that provides not only essential physical scaffolding for the cellular constituents but can also initiate crucial biochemical and biomechanical cues required for tissue morphogenesis, differentiation and homeostasis. The components are secreted by cells in the vicinity and form a sheet underlying or overlying cells such as endothelial and epithelial cells. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; placenta development : The process whose specific outcome is the progression of the placenta over time, from its formation to the mature structure. The placenta is an organ of metabolic interchange between fetus and mother, partly of embryonic origin and partly of maternal origin. ; negative regulation of transforming growth factor beta receptor signaling pathway : Any process that stops, prevents, or reduces the frequency, rate or extent of any TGF-beta receptor signaling pathway. ; negative regulation of BMP signaling pathway : Any process that stops, prevents, or reduces the frequency, rate or extent of the BMP signaling pathway. ; positive regulation of epithelial cell proliferation : Any process that activates or increases the rate or extent of epithelial cell proliferation. ; negative regulation of defense response to virus : Any process that stops, prevents or reduces the rate or extent of antiviral mechanisms, thereby facilitating viral replication. ; chorionic trophoblast cell differentiation : The process in which relatively unspecialized cells of the ectoplacental cone acquire specialized structural and/or functional features that characterize chorionic trophoblasts. These cells will migrate towards the spongiotrophoblast layer and give rise to syncytiotrophoblasts of the labyrinthine layer. ; dentinogenesis : The process whose specific outcome is the formation of dentin, the mineralized tissue that constitutes the major bulk of teeth. Dentin may be one of three types: primary dentin, secondary dentin, and tertiary dentin. ;


Symbol
HTRA1
Name
HtrA serine peptidase 1
Entrez ID
5654
Ensembl ID
ENSG00000166033    (more details)
KEGG ID
hsa:5654    (more details)
OMIM ID
600142
Uniprot ID
Q92743  
GO ID
hsa:5654    (more details)
Chromosome
1
Strand
1
Start
196888014
End
196918713
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-190a-5p (RPM: 14.2908) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-197-3p (RPM: 347.3274) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-574-5p (RPM: 176.4618) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-99a-3p (RPM: 26.3048) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Degradation of the extracellular matrix /
Sequence
ATGCAGATCCCGCGCGCCGCTCTTCTCCCGCTGCTGCTGCTGCTGCTGGCGGCGCCCGCCTCGGCGCAGCTGTCCCGGGCCGGCCGCTCGGCGCCTTTGGCCGCCGGGTGCCCAGACCGCTGCGAGCCGGCGCGCTGCCCGCCGCAGCCGGAGCACTGCGAGGGCGGCCGGGCCCGGGACGCGTGCGGCTGCTGCGAGGTGTGCGGCGCGCCCGAGGGCGCCGCGTGCGGCCTGCAGGAGGGCCCGTGCGGCGAGGGGCTGCAGTGCGTGGTGCCCTTCGGGGTGCCAGCCTCGGCCACGGTGCGGCGGCGCGCGCAGGCCGGCCTCTGTGTGTGCGCCAGCAGCGAGCCGGTGTGCGGCAGCGACGCCAACACCTACGCCAACCTGTGCCAGCTGCGCGCCGCCAGCCGCCGCTCCGAGAGGCTGCACCGGCCGCCGGTCATCGTCCTGCAGCGCGGAGCCTGCGGCCAAGGGCAGGAAGATCCCAACAGTTTGCGCCATAAATATAACTTTATCGCGGACGTGGTGGAGAAGATCGCCCCTGCCGTGGTTCATATCGAATTGTTTCGCAAGCTTCCGTTTTCTAAACGAGAGGTGCCGGTGGCTAGTGGGTCTGGGTTTATTGTGTCGGAAGATGGACTGATCGTGACAAATGCCCACGTGGTGACCAACAAGCACCGGGTCAAAGTTGAGCTGAAGAACGGTGCCACTTACGAAGCCAAAATCAAGGATGTGGATGAGAAAGCAGACATCGCACTCATCAAAATTGACCACCAGGGCAAGCTGCCTGTCCTGCTGCTTGGCCGCTCCTCAGAGCTGCGGCCGGGAGAGTTCGTGGTCGCCATCGGAAGCCCGTTTTCCCTTCAAAACACAGTCACCACCGGGATCGTGAGCACCACCCAGCGAGGCGGCAAAGAGCTGGGGCTCCGCAACTCAGACATGGACTACATCCAGACCGACGCCATCATCAACTATGGAAACTCGGGAGGCCCGTTAGTAAACCTGGACGGTGAAGTGATTGGAATTAACACTTTGAAAGTGACAGCTGGAATCTCCTTTGCAATCCCATCTGATAAGATTAAAAAGTTCCTCACGGAGTCCCATGACCGACAGGCCAAAGGAAAAGCCATCACCAAGAAGAAGTATATTGGTATCCGAATGATGTCACTCACGTCCAGCAAAGCCAAAGAGCTGAAGGACCGGCACCGGGACTTCCCAGACGTGATCTCAGGAGCGTATATAATTGAAGTAATTCCTGATACCCCAGCAGAAGCTGGTGGTCTCAAGGAAAACGACGTCATAATCAGCATCAATGGACAGTCCGTGGTCTCCGCCAATGATGTCAGCGACGTCATTAAAAGGGAAAGCACCCTGAACATGGTGGTCCGCAGGGGTAATGAAGATATCATGATCACAGTGATTCCCGAAGAAATTGACCCATAG

Back to List