Details for gene: TNFRSF10A


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; TRAIL binding : Interacting selectively and non-covalently with TRAIL (TNF-related apoptosis inducing ligand), a member of the tumor necrosis factor ligand family that rapidly induces apoptosis in a variety of transformed cell lines. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; apoptotic process : A programmed cell death process which begins when a cell receives an internal (e.g. DNA damage) or external signal (e.g. an extracellular death ligand), and proceeds through a series of biochemical events (signaling pathway phase) which trigger an execution phase. The execution phase is the last step of an apoptotic process, and is typically characterized by rounding-up of the cell, retraction of pseudopodes, reduction of cellular volume (pyknosis), chromatin condensation, nuclear fragmentation (karyorrhexis), plasma membrane blebbing and fragmentation of the cell into apoptotic bodies. When the execution phase is completed, the cell has died. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; membrane raft : Any of the small (10-200 nm), heterogeneous, highly dynamic, sterol- and sphingolipid-enriched membrane domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through protein-protein and protein-lipid interactions. ; cell surface : The external part of the cell wall and/or plasma membrane. ; signaling receptor activity : Receiving a signal and transmitting it in the cell to initiate a change in cell activity. A signal is a physical entity or change in state that is used to transfer information in order to trigger a response. ; cellular response to mechanical stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a mechanical stimulus. ; TRAIL-activated apoptotic signaling pathway : An extrinsic apoptotic signaling pathway initiated by the binding of the ligand TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) to a death receptor on the cell surface. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; protease binding : Interacting selectively and non-covalently with any protease or peptidase. ; death receptor activity : Combining with an extracellular messenger (called a death ligand), and transmitting the signal from one side of the plasma membrane to the other to initiate apoptotic or necrotic cell death. ; activation of NF-kappaB-inducing kinase activity : The stimulation of the activity of NF-kappaB-inducing kinase through phosphorylation at specific residues. ; extrinsic apoptotic signaling pathway via death domain receptors : A series of molecular signals in which a signal is conveyed from the cell surface to trigger the apoptotic death of a cell. The pathway starts with a ligand binding to a death domain receptor on the cell surface, and ends when the execution phase of apoptosis is triggered. ; extrinsic apoptotic signaling pathway : A series of molecular signals in which a signal is conveyed from the cell surface to trigger the apoptotic death of a cell. The pathway starts with either a ligand binding to a cell surface receptor, or a ligand being withdrawn from a cell surface receptor (e.g. in the case of signaling by dependence receptors), and ends when the execution phase of apoptosis is triggered. ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ; regulation of cellular process : Any process that modulates the frequency, rate or extent of a cellular process, any of those that are carried out at the cellular level, but are not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. ;


Symbol
TNFRSF10A
Name
TNF receptor superfamily member 10a
Entrez ID
8797
Ensembl ID
ENSG00000104689    (more details)
KEGG ID
hsa:8797    (more details)
OMIM ID
603611
Uniprot ID
O00220  
GO ID
hsa:8797    (more details)
Chromosome
3
Strand
-1
Start
172039578
End
172401669
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-4745-5p (RPM: 0.481) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-3133 (RPM: 0.0266) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-4695-5p (RPM: 0.009) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-1270 (RPM: 4.4328) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-365b-3p (RPM: 22.318) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-3064-3p (RPM: 0.0822) / hsa-miR-5002-5p (RPM: 0.274) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-3152-5p (RPM: 0.2428) / hsa-miR-142-5p (RPM: 245.4844) / hsa-miR-3174 (RPM: 0.2344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-4524a-3p (RPM: 0.2608) / hsa-miR-4683 (RPM: 0.0052) / hsa-miR-4758-5p (RPM: 0.0342) / hsa-miR-665 (RPM: 0.445) / hsa-miR-1271-5p (RPM: 29.1658) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-25-5p (RPM: 6.4806) / hsa-miR-483-3p (RPM: 2.3898) / hsa-miR-501-3p (RPM: 166.2736) / hsa-miR-5581-5p (RPM: 0.0032) / hsa-miR-1262 (RPM: 1.6152) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-6736-5p (RPM: 0.0498) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6501-5p (RPM: 0.0094) / hsa-miR-6840-3p (RPM: 0.0218) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Apoptosis / Cytokine-cytokine receptor interaction / Natural killer cell mediated cytotoxicity / Measles / Influenza A /
Sequence
ATGGCGCCACCACCAGCTAGAGTACATCTAGGTGCGTTCCTGGCAGTGACTCCGAATCCCGGGAGCGCAGCGAGTGGGACAGAGGCAGCCGCGGCCACACCCAGCAAAGTGTGGGGCTCTTCCGCGGGGAGGATTGAACCACGAGGCGGGGGCCGAGGAGCGCTCCCTACCTCCATGGGACAGCACGGACCCAGTGCCCGGGCCCGGGCAGGGCGCGCCCCAGGACCCAGGCCGGCGCGGGAAGCCAGCCCTCGGCTCCGGGTCCACAAGACCTTCAAGTTTGTCGTCGTCGGGGTCCTGCTGCAGGTCGTACCTAGCTCAGCTGCAACCATCAAACTTCATGATCAATCAATTGGCACACAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAGGATCTCATAGATCAGAACATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAAGAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCAGAGGGTGCCCCAGAGGGATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAGGCAATGGACATAATATATGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTCTGTTGTTGCATCGGCTCAGGTTGTGGAGGGGACCCCAAGTGCATGGACAGGGTGTGTTTCTGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAACGAGATTCTGAGCAACGCAGACTCGCTGTCCACTTTCGTCTCTGAGCAGCAAATGGAAAGCCAGGAGCCGGCAGATTTGACAGGTGTCACTGTACAGTCCCCAGGGGAGGCACAGTGTCTGCTGGGACCGGCAGAAGCTGAAGGGTCTCAGAGGAGGAGGCTGCTGGTTCCAGCAAATGGTGCTGACCCCACTGAGACTCTGATGCTGTTCTTTGACAAGTTTGCAAACATCGTGCCCTTTGACTCCTGGGACCAGCTCATGAGGCAGCTGGACCTCACGAAAAATGAGATCGATGTGGTCAGAGCTGGTACAGCAGGCCCAGGGGATGCCTTGTATGCAATGCTGATGAAATGGGTCAACAAAACTGGACGGAACGCCTCGATCCACACCCTGCTGGATGCCTTGGAGAGGATGGAAGAGAGACATGCAAGAGAGAAGATTCAGGACCTCTTGGTGGACTCTGGAAAGTTCATCTACTTAGAAGATGGCACAGGCTCTGCCGTGTCCTTGGAGTGA

Back to List