Details for gene: SQSTM1


zinc ion binding : Interacting selectively and non-covalently with zinc (Zn) ions. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; protein serine/threonine kinase activity : Catalysis of the reactions: ATP + protein serine = ADP + protein serine phosphate, and ATP + protein threonine = ADP + protein threonine phosphate. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; endosome : A vacuole to which materials ingested by endocytosis are delivered. ; late endosome : A prelysosomal endocytic organelle differentiated from early endosomes by lower lumenal pH and different protein composition. Late endosomes are more spherical than early endosomes and are mostly juxtanuclear, being concentrated near the microtubule organizing center. ; ubiquitin protein ligase binding : Interacting selectively and non-covalently with a ubiquitin protein ligase enzyme, any of the E3 proteins. ; apoptotic process : A programmed cell death process which begins when a cell receives an internal (e.g. DNA damage) or external signal (e.g. an extracellular death ligand), and proceeds through a series of biochemical events (signaling pathway phase) which trigger an execution phase. The execution phase is the last step of an apoptotic process, and is typically characterized by rounding-up of the cell, retraction of pseudopodes, reduction of cellular volume (pyknosis), chromatin condensation, nuclear fragmentation (karyorrhexis), plasma membrane blebbing and fragmentation of the cell into apoptotic bodies. When the execution phase is completed, the cell has died. ; cytoplasmic vesicle : A vesicle found in the cytoplasm of a cell. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; autophagy : The cellular catabolic process in which cells digest parts of their own cytoplasm; allows for both recycling of macromolecular constituents under conditions of cellular stress and remodeling the intracellular structure for cell differentiation. ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; autophagosome : A double-membrane-bounded compartment that engulfs endogenous cellular material as well as invading microorganisms to target them to the lytic vacuole/lysosome for degradation as part of macroautophagy. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; PML body : A class of nuclear body; they react against SP100 auto-antibodies (PML, promyelocytic leukemia); cells typically contain 10-30 PML bodies per nucleus; alterations in the localization of PML bodies occurs after viral infection. ; ubiquitin binding : Interacting selectively and non-covalently with ubiquitin, a protein that when covalently bound to other cellular proteins marks them for proteolytic degradation. ; P-body : A focus in the cytoplasm where mRNAs may become inactivated by decapping or some other mechanism. Protein and RNA localized to these foci are involved in mRNA degradation, nonsense-mediated mRNA decay (NMD), translational repression, and RNA-mediated gene silencing. ; macroautophagy : The major inducible pathway for the general turnover of cytoplasmic constituents in eukaryotic cells, it is also responsible for the degradation of active cytoplasmic enzymes and organelles during nutrient starvation. Macroautophagy involves the formation of double-membrane-bounded autophagosomes which enclose the cytoplasmic constituent targeted for degradation in a membrane-bounded structure. Autophagosomes then fuse with a lysosome (or vacuole) releasing single-membrane-bounded autophagic bodies that are then degraded within the lysosome (or vacuole). Some types of macroautophagy, e.g. pexophagy, mitophagy, involve selective targeting of the targets to be degraded. ; sarcomere : The repeating unit of a myofibril in a muscle cell, composed of an array of overlapping thick and thin filaments between two adjacent Z discs. ; enzyme binding : Interacting selectively and non-covalently with any enzyme. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; intracellular signal transduction : The process in which a signal is passed on to downstream components within the cell, which become activated themselves to further propagate the signal and finally trigger a change in the function or state of the cell. ; endosomal transport : The directed movement of substances mediated by an endosome, a membrane-bounded organelle that carries materials enclosed in the lumen or located in the endosomal membrane. ; K63-linked polyubiquitin modification-dependent protein binding : Interacting selectively and non-covalently with a protein upon poly-ubiquitination formed by linkages between lysine residues at position 63 in the target protein. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; protein kinase binding : Interacting selectively and non-covalently with a protein kinase, any enzyme that catalyzes the transfer of a phosphate group, usually from ATP, to a protein substrate. ; regulation of protein complex stability : Any process that affects the structure and integrity of a protein complex by altering the likelihood of its assembly or disassembly. ; SH2 domain binding : Interacting selectively and non-covalently with a SH2 domain (Src homology 2) of a protein, a protein domain of about 100 amino-acid residues and belonging to the alpha + beta domain class. ; protein localization : Any process in which a protein is transported to, or maintained in, a specific location. ; negative regulation of protein ubiquitination : Any process that stops, prevents, or reduces the frequency, rate or extent of the addition of ubiquitin groups to a protein. ; regulation of I-kappaB kinase/NF-kappaB signaling : Any process that modulates I-kappaB kinase/NF-kappaB signaling. ; ubiquitin-dependent protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of a ubiquitin group, or multiple ubiquitin groups, to the protein. ; protein kinase C binding : Interacting selectively and non-covalently with protein kinase C. ; regulation of mitochondrion organization : Any process that modulates the frequency, rate or extent of a process involved in the formation, arrangement of constituent parts, or disassembly of a mitochondrion. ; mitophagy : The selective autophagy process in which a mitochondrion is degraded by macroautophagy. ; endosome organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of endosomes. ; aggresome : An inclusion body formed by dynein-dependent retrograde transport of an aggregated protein on microtubules. ; autophagy of mitochondrion : The autophagic process in which mitochondria are delivered to a type of vacuole and degraded in response to changing cellular conditions. ; positive regulation of long-term synaptic potentiation : Any process that activates or increases the frequency, rate or extent of long-term synaptic potentiation. ; positive regulation of protein localization to plasma membrane : Any process that activates or increases the frequency, rate or extent of protein localization to plasma membrane. ; inclusion body : A discrete intracellular part formed of aggregated molecules such as proteins or other biopolymers. ; regulation of Ras protein signal transduction : Any process that modulates the frequency, rate or extent of Ras protein signal transduction. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; protein localization to perinuclear region of cytoplasm : A process in which a protein is transported to, or maintained in, a location within the perinuclear region of the cytoplasm. ; receptor tyrosine kinase binding : Interacting selectively and non-covalently with a receptor that possesses protein tyrosine kinase activity. ; ionotropic glutamate receptor binding : Interacting selectively and non-covalently with an ionotropic glutamate receptor. Ionotropic glutamate receptors bind glutamate and exert an effect through the regulation of ion channels. ; protein-containing complex binding : Interacting selectively and non-covalently with a macromolecular complex. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ; temperature homeostasis : A homeostatic process in which an organism modulates its internal body temperature. ; positive regulation of protein phosphorylation : Any process that activates or increases the frequency, rate or extent of addition of phosphate groups to amino acids within a protein. ; response to ischemia : Any process that results in a change in state or activity of an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a inadequate blood supply. ; protein phosphorylation : The process of introducing a phosphate group on to a protein. ; protein import into nucleus : The directed movement of a protein from the cytoplasm to the nucleus. ; aggrephagy : Selective degradation of protein aggregates by macroautophagy. ; selective autophagy : The macroautophagy process in which specific structures are targeted by the autophagy process. ; brown fat cell proliferation : The multiplication or reproduction of brown fat cells by cell division, resulting in the expansion of their population. A brown fat cell is a fat cell found the thermogenic form of adipose tissue found in newborns of many species. ; energy homeostasis : Any process involved in the balance between food intake (energy input) and energy expenditure. ; response to mitochondrial depolarisation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) in response to the depolarization of one or more mitochondria. ; amphisome : Intermediate organelles formed during macroautophagy through the fusion between autophagosomes and endosomes. ; phagophore assembly site : Punctate structures proximal to the endoplasmic reticulum which are the sites where the Atg machinery assembles upon autophagy induction. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; autolysosome : A type of secondary lysosome in which a primary lysosome has fused with the outer membrane of an autophagosome. It is involved in the second step of autophagy in which it degrades contents with acidic lysosomal hydrolases. ; sperm midpiece : The highly organized segment of the sperm flagellum which begins at the connecting piece and is characterized by the presence of 9 outer dense fibers (ODFs) that lie outside each of the 9 outer axonemal microtubule doublets and by a sheath of mitochondria that encloses the ODFs and the axoneme; the midpiece terminates about one-fourth of the way down the sperm flagellum at the annulus, which marks the beginning of the principal piece. ; Lewy body : Cytoplasmic, spherical inclusion commonly found in damaged neurons, and composed of abnormally phosphorylated, neurofilament proteins aggregated with ubiquitin and alpha-synuclein. ;


Symbol
SQSTM1
Name
sequestosome 1
Entrez ID
8878
Ensembl ID
ENSG00000161011    (more details)
KEGG ID
hsa:8878    (more details)
OMIM ID
167250
Uniprot ID
Q13501  
GO ID
hsa:8878    (more details)
Chromosome
13
Strand
1
Start
40555667
End
40666641
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-3613-3p (RPM: 0.8106) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-520d-5p (RPM: 0.0084) / hsa-miR-2277-3p (RPM: 1.3888) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-23a-5p (RPM: 7.4168) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-129-1-3p (RPM: 8.647) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-654-5p (RPM: 2.4606) / hsa-miR-603 (RPM: 0.0052) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-125b-2-3p (RPM: 492.7724) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-7-1-3p (RPM: 13.9534) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-3065-3p (RPM: 17.8542) / hsa-miR-328-3p (RPM: 137.931) / hsa-miR-187-5p (RPM: 0.2682) / hsa-miR-298 (RPM: 0.0032) / hsa-miR-5093 (RPM: 0.0162) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-4712-3p (RPM: 0.0536) / hsa-miR-5087 (RPM: 0.0074) / hsa-miR-331-3p (RPM: 130.5788) / hsa-miR-302c-3p (RPM: 0.0012) / hsa-miR-193a-3p (RPM: 13.6064) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-1229-3p (RPM: 1.3764) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-342-5p (RPM: 28.1628) / hsa-miR-641 (RPM: 12.2284) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-505-5p (RPM: 1.7508) / hsa-miR-422a (RPM: 0.3564) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-3925-5p (RPM: 0.0038) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-135b-3p (RPM: 2.2482) / hsa-miR-320e (RPM: 0.223) / hsa-miR-877-5p (RPM: 44.6348) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-590-5p (RPM: 0.1536) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-615-5p (RPM: 0.0058) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-122-3p (RPM: 0.003) / hsa-miR-548e-5p (RPM: 0.4844) / hsa-miR-1252-3p (RPM: 0.0174) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Osteoclast differentiation /
Sequence
ATGGCGTCGCTCACCGTGAAGGCCTACCTTCTGGGCAAGGAGGACGCGGCGCGCGAGATTCGCCGCTTCAGCTTCTGCTGCAGCCCCGAGCCTGAGGCGGAAGCCGAGGCTGCGGCGGGTCCGGGACCCTGCGAGCGGCTGCTGAGCCGGGTGGCCGCCCTGTTCCCCGCGCTGCGGCCTGGCGGCTTCCAGGCGCACTACCGCGATGAGGACGGGGACTTGGTTGCCTTTTCCAGTGACGAGGAATTGACAATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAAGAGAAAAAAGAGTGCCGGCGGGACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAACATGGTGCACCCCAATGTGATCTGCGATGGCTGCAATGGGCCTGTGGTAGGAACCCGCTACAAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTCTGCGAGGGAAAGGGCTTGCACCGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCTGAGGGCTTCTCGCACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAAATGGGTCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCCACGGCAGAATCAGCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTGGGGAGAGTGTGGCAGCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTGACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCTGACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATCGCCTTGGAGTCCGAGGGGCGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGACTGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAATCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTACCCACATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGCTTCTCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGACACCATCCAGTATTCAAAGCATCCCCCGCCGTTGTGA

Back to List