Details for gene: FBLN5


extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; calcium ion binding : Interacting selectively and non-covalently with calcium ions (Ca2+). ; elastic fiber assembly : Assembly of the extracellular matrix fibers that enables the matrix to recoil after transient stretching. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; regulation of cell growth : Any process that modulates the frequency, rate, extent or direction of cell growth. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; collagen-containing extracellular matrix : An extracellular matrix consisting mainly of proteins (especially collagen) and glycosaminoglycans (mostly as proteoglycans) that provides not only essential physical scaffolding for the cellular constituents but can also initiate crucial biochemical and biomechanical cues required for tissue morphogenesis, differentiation and homeostasis. The components are secreted by cells in the vicinity and form a sheet underlying or overlying cells such as endothelial and epithelial cells. ; integrin binding : Interacting selectively and non-covalently with an integrin. ; protein C-terminus binding : Interacting selectively and non-covalently with a protein C-terminus, the end of any peptide chain at which the 1-carboxyl function of a constituent amino acid is not attached in peptide linkage to another amino-acid residue. ; extracellular matrix : A structure lying external to one or more cells, which provides structural support, biochemical or biomechanical cues for cells or tissues. ; cell-matrix adhesion : The binding of a cell to the extracellular matrix via adhesion molecules. ; regulation of removal of superoxide radicals : Any process that modulates the frequency, rate or extent of removal of superoxide radicals. ; extracellular matrix constituent conferring elasticity : A component of the extracellular matrix that enables the matrix to recoil after transient stretching. ; elastic fiber : An supramolecular fiber that consists of an insoluble core of polymerized tropoelastin monomers and a surrounding mantle of microfibrils. Elastic fibers provide elasticity and recoiling to tissues and organs, and maintain structural integrity against mechanical strain. ; protein localization to cell surface : A process in which a protein is transported to, or maintained in, a location within the external part of the cell wall and/or plasma membrane. ; secretion : The controlled release of a substance by a cell or a tissue. ;


Symbol
FBLN5
Name
fibulin 5
Entrez ID
10516
Ensembl ID
ENSG00000140092    (more details)
KEGG ID
hsa:10516    (more details)
OMIM ID
219100
Uniprot ID
A0A024R6G3  
GO ID
hsa:10516    (more details)
Chromosome
17
Strand
-1
Start
2054154
End
2063241
miRNA Interactions
hsa-miR-3190-3p (RPM: 0.0858) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-2277-3p (RPM: 1.3888) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-488-3p (RPM: 11.3394) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-542-3p (RPM: 2.7294) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-3681-3p (RPM: 0.0012) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-326 (RPM: 10.9272) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-3120-3p (RPM: 0.0294) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-151a-3p (RPM: 2381.562) / hsa-miR-6770-5p (RPM: 0.0456) / hsa-miR-216a-3p (RPM: 5.8012) / hsa-miR-7854-3p (RPM: 0.437) / hsa-miR-4433b-3p (RPM: 0.0038) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Elastic fibre formation / Molecules associated with elastic fibres /
Sequence
ATGCCAGGAATAAAAAGGATACTCACTGTTACCATTCTGGCTCTCTGTCTTCCAAGCCCTGGGAATGCACAGGCACAGTGCACGAATGGCTTTGACCTGGATCGCCAGTCAGGACAGTGTTTAGATATTGATGAATGCCGAACCATCCCCGAGGCCTGCCGAGGAGACATGATGTGTGTTAACCAAAATGGCGGGTATTTATGCATTCCCCGGACAAACCCTGTGTATCGAGGGCCCTACTCGAACCCCTACTCGACCCCCTACTCAGGTCCGTACCCAGCAGCTGCCCCACCACTCTCAGCTCCAAACTATCCCACGATCTCCAGGCCTCTTATATGCCGCTTTGGATACCAGATGGATGAAAGCAACCAATGTGTGGATGTGGACGAGTGTGCAACAGATTCCCACCAGTGCAACCCCACCCAGATCTGCATCAATACTGAAGGCGGGTACACCTGCTCCTGCACCGACGGATATTGGCTTCTGGAAGGCCAGTGCTTAGACATTGATGAATGTCGCTATGGTTACTGCCAGCAGCTCTGTGCGAATGTTCCTGGATCCTATTCTTGTACATGCAACCCTGGTTTTACCCTCAATGAGGATGGAAGGTCTTGCCAAGATGTGAACGAGTGTGCCACCGAGAACCCCTGCGTGCAAACCTGCGTCAACACCTACGGCTCTTTCATCTGCCGCTGTGACCCAGGATATGAACTTGAGGAAGATGGCGTTCATTGCAGTGATATGGACGAGTGCAGCTTCTCTGAGTTCCTCTGCCAACATGAGTGTGTGAACCAGCCCGGCACATACTTCTGCTCCTGCCCTCCAGGCTACATCCTGCTGGATGACAACCGAAGCTGCCAAGACATCAACGAATGTGAGCACAGGAACCACACGTGCAACCTGCAGCAGACGTGCTACAATTTACAAGGGGGCTTCAAATGCATTGACCCCATCCGCTGTGAGGAGCCTTATCTGAGGATCAGTGATAACCGCTGTATGTGTCCTGCTGAGAACCCTGGCTGCAGAGACCAGCCCTTTACCATCTTGTACCGGGACATGGACGTGGTGTCAGGACGCTCCGTTCCCGCTGACATCTTCCAAATGCAAGCCACGACCCGCTACCCTGGGGCCTATTACATTTTCCAGATCAAATCTGGGAATGAGGGCAGAGAATTTTACATGCGGCAAACGGGCCCCATCAGTGCCACCCTGGTGATGACACGCCCCATCAAAGGGCCCCGGGAAATCCAGCTGGACTTGGAAATGATCACTGTCAACACTGTCATCAACTTCAGAGGCAGCTCCGTGATCCGACTGCGGATATATGTGTCGCAGTACCCATTCTGA

Back to List