Details for gene: CFHR4


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; lipid transport : The directed movement of lipids into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Lipids are compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. ; lipid transporter activity : Enables the directed movement of lipids into, out of or within a cell, or between cells. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ;


Symbol
CFHR4
Name
complement factor H related 4
Entrez ID
10877
Ensembl ID
ENSG00000134365    (more details)
KEGG ID
hsa:10877    (more details)
OMIM ID
605337
Uniprot ID
Q92496  
GO ID
hsa:10877    (more details)
Chromosome
1
Strand
1
Start
185734391
End
186190949
miRNA Interactions
hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-129-2-3p (RPM: 79.8688) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Sequence
ATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGACAAGAAGTGAAACCTTGTGATTTTCCAGAAATTCAACATGGAGGTCTATATTATAAGAGTTTGCGTAGACTATACTTTCCAGCAGCTGCAGGACAATCTTATTCCTATTACTGTGATCAAAATTTTGTGACTCCTTCAGGAAGTTACTGGGATTACATTCATTGCACACAAGATGGTTGGTCACCAACGGTCCCATGCCTCAGAACATGCTCAAAATCAGATGTAGAAATTGAAAATGGATTCATTTCTGAATCTTCCTCTATTTATATTTTAAATGAAGAAACACAATATAATTGTAAACCAGGATATGCAACAGCAGAGGGAAATTCTTCAGGATCAATTACATGTTTGCAAAATGGATGGTCAACACAACCAATTTGCATTAAATTTTGTGATATGCCTGTTTTTGAGAATTCCAGAGCCAAGAGTAATGGCATGTGGTTTAAGCTCCATGACACATTGGACTATGAATGCTATGATGGATATGAAAGCAGTTATGGAAACACCACAGATTCCATAGTGTGTGGTGAAGATGGCTGGTCCCATTTGCCAACATGCTATAATTCTTCAGAAAACTGTGGGCCTCCTCCACCTATTAGCAATGGAGATACCACGTCCTTCCCGCAAAAAGTGTATCTGCCATGGTCAAGAGTCGAGTACCAGTGCCAGTCCTACTATGAACTTCAGGGTTCTAAATATGTAACATGTAGTAATGGAGACTGGTCAGAACCACCAAGATGCATATCAATGAAACCTTGTGAGTTTCCAGAAATTCAACATGGACATCTATATTATGAGAATACGCGTAGACCATACTTTCCAGTAGCTACAGGACAATCTTACTCCTATTACTGTGACCAAAATTTTGTGACTCCTTCAGGAAGTTACTGGGATTACATTCACTGCACACAAGATGGGTGGTTGCCAACAGTCCCATGCCTCAGAACATGCTCAAAATCAGATATAGAAATTGAAAATGGATTCATTTCTGAATCTTCCTCTATTTATATTTTAAATAAAGAAATACAATATAAATGTAAACCAGGATATGCAACAGCAGATGGAAATTCTTCAGGTTCAATTACATGTTTGCAAAATGGATGGTCAGCACAACCAATTTGCATTAAATTTTGTGATATGCCTGTTTTTGAGAATTCCAGAGCCAAGAGTAATGGCATGCGGTTTAAGCTCCATGACACATTGGACTACGAATGCTACGATGGATATGAAATCAGTTATGGAAACACCACAGGTTCCATAGTGTGTGGTGAAGATGGGTGGTCCCATTTCCCAACATGTTATAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACCTCCTTTCTACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGTCCTACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCCATGTATAATAACTGAAGAAAACATGAATAAAAATAACATACAGTTAAAAGGAAAAAGTGACATAAAATATTATGCAAAAACAGGGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCGAATACATCAGTTCTATCATTTCAAGCAGTGTGTAGGGAAGGCATAGTGGAATACCCCAGATGCGAATAA

Back to List