Details for gene: CFHR3


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; blood microparticle : A phospholipid microvesicle that is derived from any of several cell types, such as platelets, blood cells, endothelial cells, or others, and contains membrane receptors as well as other proteins characteristic of the parental cell. Microparticles are heterogeneous in size, and are characterized as microvesicles free of nucleic acids. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ;


Symbol
CFHR3
Name
complement factor H related 3
Entrez ID
10878
Ensembl ID
ENSG00000116785    (more details)
KEGG ID
hsa:10878    (more details)
OMIM ID
235400
Uniprot ID
Q02985  
GO ID
hsa:10878    (more details)
Chromosome
10
Strand
1
Start
122458551
End
122514907
miRNA Interactions
hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-576-5p (RPM: 10.7352) / hsa-miR-3174 (RPM: 0.2344) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-34c-5p (RPM: 46.7356) / hsa-miR-5585-3p (RPM: 0.2034) / hsa-miR-5007-3p (RPM: 0.0008) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-181a-3p (RPM: 391.4974) / hsa-miR-7151-5p (RPM: 0.0134) /
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Regulation of Complement cascade /
Sequence
ATGTTGTTACTAATCAATGTCATTCTGACCTTGTGGGTTTCCTGTGCTAATGGACAAGTGAAACCTTGTGATTTTCCAGACATTAAACATGGAGGTCTATTTCATGAGAATATGCGTAGACCATACTTTCCAGTAGCTGTAGGAAAATATTACTCCTATTACTGTGATGAACATTTTGAGACTCCTTCAGGAAGTTACTGGGATTACATTCATTGCACACAAAATGGGTGGTCACCAGCAGTACCATGTCTCAGAAAATGTTATTTTCCTTATTTGGAAAATGGATATAATCAAAATTATGGAAGAAAGTTTGTACAGGGTAACTCTACAGAAGTTGCCTGCCATCCTGGCTACGGTCTTCCAAAAGCGCAGACCACAGTTACATGTACGGAGAAAGGCTGGTCTCCTACTCCCAGATGCATCCGTGTCAGAACATGCTCAAAATCAGATATAGAAATTGAAAATGGATTCATTTCCGAATCTTCCTCTATTTATATTTTAAATAAAGAAATACAATATAAATGTAAACCAGGATATGCAACAGCAGATGGAAATTCTTCAGGATCAATTACATGTTTGCAAAATGGATGGTCAGCACAACCAATTTGCATTAATTCTTCAGAAAAGTGTGGGCCTCCTCCACCTATTAGCAATGGTGATACCACCTCCTTTCTACTAAAAGTGTATGTGCCACAGTCAAGAGTCGAGTACCAATGCCAGCCCTACTATGAACTTCAGGGTTCTAATTATGTAACATGTAGTAATGGAGAGTGGTCGGAACCACCAAGATGCATACATCCATGTATAATAACTGAAGAAAACATGAATAAAAATAACATAAAGTTAAAAGGAAGAAGTGACAGAAAATATTATGCAAAAACAGGGGATACCATTGAATTTATGTGTAAATTGGGATATAATGCAAATACATCAATTCTATCATTTCAAGCAGTGTGTCGGGAAGGGATAGTGGAATACCCCAGATGCGAATAA

Back to List