Details for gene: RAX2


DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; DNA-binding transcription activator activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets transcribed by RNA polymerase II. ;


Symbol
RAX2
Name
retina and anterior neural fold homeobox 2
Entrez ID
84839
Ensembl ID
ENSG00000173976    (more details)
KEGG ID
hsa:84839    (more details)
OMIM ID
610362
Uniprot ID
Q96IS3  
GO ID
hsa:84839    (more details)
Chromosome
7
Strand
-1
Start
140023749
End
140062951
miRNA Interactions
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Sequence
ATGTTCCTGAGCCCGGGCGAGGGGCCGGCAACCGAGGGTGGGGGTCTGGGGCCGGGCGAGGAGGCCCCCAAGAAGAAGCACCGGAGGAACCGCACCACCTTCACCACCTACCAGCTGCACCAGCTGGAGCGGGCGTTCGAGGCCTCTCACTACCCGGATGTGTACAGCCGTGAGGAGCTGGCAGCCAAGGTGCACCTACCTGAGGTGCGCGTGCAGGTGTGGTTCCAGAACCGCCGGGCCAAGTGGCGCCGCCAGGAGCGGCTGGAGTCAGGCTCGGGTGCCGTGGCAGCTCCGAGACTCCCCGAGGCCCCAGCGCTGCCGTTCGCCCGCCCCCCGGCCATGTCGCTGCCCCTGGAGCCCTGGTTGGGCCCCGGACCGCCGGCCGTGCCAGGCCTCCCCCGCCTCCTGGGCCCGGGCCCGGGGCTGCAAGCGTCCTTCGGGCCTCATGCCTTTGCTCCCACCTTCGCAGATGGCTTCGCCCTGGAGGAGGCGTCCCTGCGGCTGCTGGCCAAGGAACATGCACAGGCTCTGGACAGGGCCTGGCCGCCAGCCTGA

Back to List