Details for gene: ARMS2


cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; retina homeostasis : A tissue homeostatic process involved in the maintenance of an internal equilibrium within the retina of the eye, including control of cellular proliferation and death and control of metabolic function. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ;


Symbol
ARMS2
Name
age-related maculopathy susceptibility 2
Entrez ID
387715
Ensembl ID
ENSG00000254636    (more details)
KEGG ID
hsa:387715    (more details)
OMIM ID
611313
Uniprot ID
P0C7Q2  
GO ID
hsa:387715    (more details)
Chromosome
19
Strand
1
Start
3769089
End
3772228
miRNA Interactions
Involved Diseases
Age-related macular degeneration (AMD) /
Involved Pathways
Sequence
ATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGGAAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCCACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAGAGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTCTGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTCAGCACCACCTGACACTGTCTATCATCCACACTGCAGCAAGGTGA

Back to List