Details for gene: CYP2R1


monooxygenase activity : Catalysis of the incorporation of one atom from molecular oxygen into a compound and the reduction of the other atom of oxygen to water. ; heme binding : Interacting selectively and non-covalently with heme, any compound of iron complexed in a porphyrin (tetrapyrrole) ring. ; iron ion binding : Interacting selectively and non-covalently with iron (Fe) ions. ; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen : Catalysis of an oxidation-reduction (redox) reaction in which hydrogen or electrons are transferred from each of two donors, and molecular oxygen is reduced or incorporated into a donor. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; oxidoreductase activity : Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; steroid hydroxylase activity : Catalysis of the formation of a hydroxyl group on a steroid by incorporation of oxygen from O2. ; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen : Catalysis of an oxidation-reduction (redox) reaction in which hydrogen or electrons are transferred from reduced flavin or flavoprotein and one other donor, and one atom of oxygen is incorporated into one donor. ; organic acid metabolic process : The chemical reactions and pathways involving organic acids, any acidic compound containing carbon in covalent linkage. ; xenobiotic metabolic process : The chemical reactions and pathways involving a xenobiotic compound, a compound foreign to living organisms. Used of chemical compounds, e.g. a xenobiotic chemical, such as a pesticide. ; xenobiotic catabolic process : The chemical reactions and pathways resulting in the breakdown of a xenobiotic compound, a compound foreign to living organisms. Used of chemical compounds, e.g. a xenobiotic chemical, such as a pesticide. ; vitamin metabolic process : The chemical reactions and pathways involving vitamins. Vitamin is a general term for a number of unrelated organic substances that occur in many foods in small amounts and that are necessary in trace amounts for the normal metabolic functioning of the body. Vitamins may be water-soluble or fat-soluble and usually serve as components of coenzyme systems. ; calcitriol biosynthetic process from calciol : Conversion of vitamin D3 from its largely inactive form (calciol, also called cholecalciferol) into a hormonally active form (calcitriol). Conversion requires 25-hydroxylation of calciol in the liver to form calcidiol, and subsequent 1,alpha-hydroxylation of calcidiol in the kidney to form calcitriol. ; vitamin D metabolic process : The chemical reactions and pathways involving vitamin D, any of a group of related, fat-soluble compounds that are derived from delta-5,7 steroids and play a central role in calcium metabolism. Specific forms of vitamin D include calciferol (ergocalciferol; vitamin D2) and cholecalciferol (calciol; vitamin D3). ; vitamin D biosynthetic process : The chemical reactions and pathways resulting in the formation of vitamin D, any of a group of related, fat-soluble compounds that are derived from delta-5,7 steroids and play a central role in calcium metabolism. Specific forms of vitamin D include calciferol (ergocalciferol; vitamin D2) and cholecalciferol (calciol; vitamin D3). ; vitamin D3 25-hydroxylase activity : Catalysis of the reaction: vitamin D3 + NADPH + H+ + O2 = calcidiol + NADP+ + H2O. ; D3 vitamins binding : Interacting selectively and non-covalently with D3 vitamins. ;


Symbol
CYP2R1
Name
cytochrome P450 family 2 subfamily R member 1
Entrez ID
120227
Ensembl ID
ENSG00000186104    (more details)
KEGG ID
hsa:120227    (more details)
OMIM ID
600081
Uniprot ID
Q6VVX0  
GO ID
hsa:120227    (more details)
Chromosome
5
Strand
-1
Start
179806398
End
179838078
miRNA Interactions
hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-3065-3p (RPM: 17.8542) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-4491 (RPM: 0.003) /
Involved Diseases
Vogt-Koyanagi-Harada disease /
Involved Pathways
Metabolic pathways / Steroid biosynthesis /
Sequence
ATGTGGAAGCTTTGGAGAGCTGAAGAGGGCGCGGCGGCGCTCGGCGGCGCGCTCTTCCTGCTGCTCTTCGCGCTAGGGGTCCGCCAGCTGCTGAAGCAGAGGCGGCCGATGGGCTTCCCCCCGGGGCCGCCGGGGCTGCCATTTATCGGCAACATCTATTCCCTGGCAGCCTCATCCGAGCTTCCCCATGTCTACATGAGAAAGCAGAGCCAGGTGTACGGAGAGATCTTCAGTTTAGATCTTGGAGGCATATCAACTGTGGTTCTAAATGGCTATGATGTAGTAAAGGAATGCCTTGTTCATCAAAGCGAAATTTTTGCAGACAGACCATGCCTTCCTTTATTCATGAAGATGACAAAAATGGGAGGCTTACTCAATTCCAGATATGGCCGAGGATGGGTTGATCACAGACGATTAGCTGTAAACAGTTTTCGATATTTTGGATATGGCCAAAAGTCTTTTGAATCTAAAATCTTGGAAGAAACCAAATTTTTCAATGATGCTATTGAAACATACAAAGGTAGACCTTTTGACTTTAAACAGTTAATAACGAATGCTGTTTCAAACATAACCAATCTGATCATTTTTGGAGAACGATTCACTTATGAAGACACCGATTTTCAGCACATGATTGAGTTATTTAGTGAAAATGTGGAACTAGCTGCCAGTGCCTCAGTCTTCTTGTATAATGCCTTTCCATGGATTGGCATCCTGCCTTTTGGAAAACATCAACAGCTGTTTAGAAATGCAGCTGTAGTCTATGATTTTCTCTCCAGACTCATTGAAAAAGCTTCAGTCAACAGAAAGCCTCAGCTACCTCAGCATTTTGTTGATGCTTATTTAGATGAGATGGATCAAGGTAAAAATGACCCATCATCTACTTTCTCCAAAGAAAACCTAATTTTCTCAGTGGGTGAACTCATCATTGCTGGAACTGAAACTACAACCAATGTGCTACGGTGGGCGATTCTTTTCATGGCCCTTTATCCTAATATTCAAGGACAAGTTCAGAAAGAGATTGATTTAATTATGGGCCCTAATGGGAAGCCTTCTTGGGACGACAAATGCAAAATGCCTTATACTGAGGCAGTTTTGCATGAAGTTTTAAGATTCTGTAATATAGTTCCATTAGGGATTTTCCATGCAACCTCTGAAGATGCAGTTGTACGTGGTTATTCCATTCCTAAAGGCACAACAGTAATTACAAATCTTTATTCTGTACACTTTGATGAAAAGTACTGGAGAGACCCAGAAGTGTTCCATCCTGAGCGATTTCTGGACAGCAGTGGATATTTTGCCAAGAAGGAAGCTTTGGTTCCTTTTTCCCTAGGAAGAAGACATTGTCTTGGAGAACACTTGGCTCGGATGGAAATGTTCTTGTTTTTTACAGCATTGCTTCAGAGGTTTCATTTGCATTTTCCACATGAACTAGTTCCAGATCTGAAGCCCAGGTTAGGCATGACATTGCAGCCCCAACCCTACCTCATCTGTGCTGAAAGACGCTGA

Back to List