Details for gene: FOXO1


regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; sequence-specific DNA binding : Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; ubiquitin protein ligase binding : Interacting selectively and non-covalently with a ubiquitin protein ligase enzyme, any of the E3 proteins. ; apoptotic process : A programmed cell death process which begins when a cell receives an internal (e.g. DNA damage) or external signal (e.g. an extracellular death ligand), and proceeds through a series of biochemical events (signaling pathway phase) which trigger an execution phase. The execution phase is the last step of an apoptotic process, and is typically characterized by rounding-up of the cell, retraction of pseudopodes, reduction of cellular volume (pyknosis), chromatin condensation, nuclear fragmentation (karyorrhexis), plasma membrane blebbing and fragmentation of the cell into apoptotic bodies. When the execution phase is completed, the cell has died. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; negative regulation of transcription, DNA-templated : Any process that stops, prevents, or reduces the frequency, rate or extent of cellular DNA-templated transcription. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; cellular response to DNA damage stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; autophagy : The cellular catabolic process in which cells digest parts of their own cytoplasm; allows for both recycling of macromolecular constituents under conditions of cellular stress and remodeling the intracellular structure for cell differentiation. ; positive regulation of transcription, DNA-templated : Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; protein acetylation : The addition of an acetyl group to a protein amino acid. An acetyl group is CH3CO-, derived from acetic [ethanoic] acid. ; chromatin binding : Interacting selectively and non-covalently with chromatin, the network of fibers of DNA, protein, and sometimes RNA, that make up the chromosomes of the eukaryotic nucleus during interphase. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; fat cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an adipocyte, an animal connective tissue cell specialized for the synthesis and storage of fat. ; positive regulation of autophagy : Any process that activates, maintains or increases the rate of autophagy. Autophagy is the process in which cells digest parts of their own cytoplasm. ; cellular response to starvation : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of deprivation of nourishment. ; positive regulation of protein catabolic process : Any process that activates or increases the frequency, rate or extent of the chemical reactions and pathways resulting in the breakdown of a protein by the destruction of the native, active configuration, with or without the hydrolysis of peptide bonds. ; cellular response to oxidative stress : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of oxidative stress, a state often resulting from exposure to high levels of reactive oxygen species, e.g. superoxide anions, hydrogen peroxide (H2O2), and hydroxyl radicals. ; insulin receptor signaling pathway : The series of molecular signals generated as a consequence of the insulin receptor binding to insulin. ; negative regulation of fat cell differentiation : Any process that stops, prevents, or reduces the frequency, rate or extent of adipocyte differentiation. ; cellular glucose homeostasis : A cellular homeostatic process involved in the maintenance of an internal steady state of glucose within a cell or between a cell and its external environment. ; cellular response to insulin stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an insulin stimulus. Insulin is a polypeptide hormone produced by the islets of Langerhans of the pancreas in mammals, and by the homologous organs of other organisms. ; energy homeostasis : Any process involved in the balance between food intake (energy input) and energy expenditure. ; DNA-binding transcription activator activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets transcribed by RNA polymerase II. ; response to fatty acid : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a fatty acid stimulus. ; beta-catenin binding : Interacting selectively and non-covalently with the beta subunit of the catenin complex. ; protein phosphatase 2A binding : Interacting selectively and non-covalently with the enzyme protein phosphatase 2A. ; temperature homeostasis : A homeostatic process in which an organism modulates its internal body temperature. ; cellular response to hyperoxia : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating increased oxygen tension. ; negative regulation of cardiac muscle hypertrophy in response to stress : Any process that stops, prevents or reduces the frequency, rate or extent of cardiac muscle hypertrophy in response to stress. ; negative regulation of stress-activated MAPK cascade : Any process that stops, prevents, or reduces the frequency, rate or extent of signal transduction mediated by the stress-activated MAPK cascade. ; cellular response to nitric oxide : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a nitric oxide stimulus. ; DNA-binding transcription repressor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that represses or decreases the transcription of specific gene sets transcribed by RNA polymerase II. ; chromatin DNA binding : Interacting selectively and non-covalently with DNA that is assembled into chromatin. ; promoter-specific chromatin binding : Interacting selectively and non-covalently with a section of chromatin that is associated with gene promoter sequences of DNA. ; blood vessel development : The process whose specific outcome is the progression of a blood vessel over time, from its formation to the mature structure. The blood vessel is the vasculature carrying blood. ; regulation of gluconeogenesis : Any process that modulates the frequency, rate or extent of gluconeogenesis, the formation of glucose from noncarbohydrate precursors, such as pyruvate, amino acids and glycerol. ; regulation of cell population proliferation : Any process that modulates the frequency, rate or extent of cell proliferation. ; glucose homeostasis : Any process involved in the maintenance of an internal steady state of glucose within an organism or cell. ; positive regulation of gluconeogenesis : Any process that activates or increases the frequency, rate or extent of gluconeogenesis. ; cellular response to cold : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a cold stimulus, a temperature stimulus below the optimal temperature for that organism. ; negative regulation of canonical Wnt signaling pathway : Any process that decreases the rate, frequency, or extent of the Wnt signaling pathway through beta-catenin, the series of molecular signals initiated by binding of a Wnt protein to a frizzled family receptor on the surface of the target cell, followed by propagation of the signal via beta-catenin, and ending with a change in transcription of target genes. ; neuronal stem cell population maintenance : Any process in by an organism or tissue maintains a population of neuronal stem cells. ; regulation of neural precursor cell proliferation : Any process that modulates the frequency, rate or extent of neural precursor cell proliferation. ; regulation of reactive oxygen species metabolic process : Any process that modulates the frequency, rate or extent of reactive oxygen species metabolic process. ; : ;


Symbol
FOXO1
Name
forkhead box O1
Entrez ID
2308
Ensembl ID
ENSG00000150907    (more details)
KEGG ID
hsa:2308    (more details)
OMIM ID
136533
Uniprot ID
Q12778  
GO ID
hsa:2308    (more details)
Chromosome
22
Strand
-1
Start
32801705
End
32863041
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-4803 (RPM: 0.0328) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-4753-3p (RPM: 0.0312) / hsa-miR-942-5p (RPM: 2.297) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-544a (RPM: 0.082) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-944 (RPM: 13.3166) / hsa-miR-223-3p (RPM: 14.321) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-582-5p (RPM: 8.1398) / hsa-miR-96-5p (RPM: 1417.2834) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-582-3p (RPM: 12.5308) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-452-5p (RPM: 23.696) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-153-3p (RPM: 53.4548) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-486-5p (RPM: 3314.1068) / hsa-miR-876-5p (RPM: 0.4744) / hsa-miR-10a-3p (RPM: 0.0878) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-5000-5p (RPM: 0.049) / hsa-miR-548d-5p (RPM: 1.1692) / hsa-miR-33a-3p (RPM: 1.692) / hsa-miR-548au-5p (RPM: 0.1902) / hsa-miR-548c-5p (RPM: 0.235) / hsa-miR-548am-5p (RPM: 0.2292) / hsa-miR-548o-5p (RPM: 0.235) / hsa-miR-499a-3p (RPM: 0.2716) / hsa-miR-548j-5p (RPM: 0.0632) / hsa-miR-4733-5p (RPM: 0.1604) / hsa-miR-1253 (RPM: 0.0136) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-3934-5p (RPM: 0.4022) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-3177-5p (RPM: 0.1208) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-545-3p (RPM: 0.0276) / hsa-miR-1271-5p (RPM: 29.1658) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-532-5p (RPM: 129.2058) / hsa-miR-499b-3p (RPM: 0.0032) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-3925-5p (RPM: 0.0038) / hsa-miR-324-3p (RPM: 32.0094) / hsa-miR-502-3p (RPM: 26.4154) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-501-3p (RPM: 166.2736) / hsa-miR-562 (RPM: 0.002) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-1251-5p (RPM: 1.1972) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-376a-3p (RPM: 4.1692) / hsa-miR-34c-3p (RPM: 1.7712) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-935 (RPM: 3.3072) / hsa-miR-520g-3p (RPM: 0.0022) / hsa-miR-520h (RPM: 0.0012) / hsa-miR-106b-3p (RPM: 83.1096) / hsa-miR-625-3p (RPM: 10.649) / hsa-miR-181c-3p (RPM: 135.7028) / hsa-miR-518f-5p (RPM: 0.0012) / hsa-miR-941 (RPM: 399.631) / hsa-miR-519b-5p (RPM: 0.0018) / hsa-miR-519c-5p (RPM: 0.0018) / hsa-miR-519a-5p (RPM: 0.0018) / hsa-miR-523-5p (RPM: 0.0018) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-518e-5p (RPM: 0.0018) / hsa-miR-518d-5p (RPM: 0.0002) / hsa-miR-520c-5p (RPM: 0.0002) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-517-5p (RPM: 0.003) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-324-5p (RPM: 32.337) / hsa-miR-132-5p (RPM: 5.9596) / hsa-let-7c-3p (RPM: 2.464) / hsa-miR-6715a-3p (RPM: 0.0842) / hsa-miR-215-3p (RPM: 0.0012) /
Involved Diseases
Keratoconus /
Involved Pathways
FoxO signaling pathway / Thyroid hormone signaling pathway / Glucagon signaling pathway / Pathways in cancer / AMPK signaling pathway / Insulin signaling pathway /
Sequence
ATGGCCGAGGCGCCTCAGGTGGTGGAGATCGACCCGGACTTCGAGCCGCTGCCCCGGCCGCGCTCGTGCACCTGGCCGCTGCCCAGGCCGGAGTTTAGCCAGTCCAACTCGGCCACCTCCAGCCCGGCGCCGTCGGGCAGCGCGGCTGCCAACCCCGACGCCGCGGCGGGCCTGCCCTCGGCCTCGGCTGCCGCTGTCAGCGCCGACTTCATGAGCAACCTGAGCTTGCTGGAGGAGAGCGAGGACTTCCCGCAGGCGCCCGGCTCCGTGGCGGCGGCGGTGGCGGCGGCGGCCGCCGCGGCCGCCACCGGGGGGCTGTGCGGGGACTTCCAGGGCCCGGAGGCGGGCTGCCTGCACCCAGCGCCACCGCAGCCCCCGCCGCCCGGGCCGCTGTCGCAGCACCCGCCGGTGCCCCCCGCCGCCGCTGGGCCGCTCGCGGGGCAGCCGCGCAAGAGCAGCTCGTCCCGCCGCAACGCGTGGGGCAACCTGTCCTACGCCGACCTCATCACCAAGGCCATCGAGAGCTCGGCGGAGAAGCGGCTCACGCTGTCGCAGATCTACGAGTGGATGGTCAAGAGCGTGCCCTACTTCAAGGATAAGGGTGACAGCAACAGCTCGGCGGGCTGGAAGAATTCAATTCGTCATAATCTGTCCCTACACAGCAAGTTCATTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGGATGCTCAATCCAGAGGGTGGCAAGAGCGGGAAATCTCCTAGGAGAAGAGCTGCATCCATGGACAACAACAGTAAATTTGCTAAGAGCCGAAGCCGAGCTGCCAAGAAGAAAGCATCTCTCCAGTCTGGCCAGGAGGGTGCTGGGGACAGCCCTGGATCACAGTTTTCCAAATGGCCTGCAAGCCCTGGCTCTCACAGCAATGATGACTTTGATAACTGGAGTACATTTCGCCCTCGAACTAGCTCAAATGCTAGTACTATTAGTGGGAGACTCTCACCCATTATGACCGAACAGGATGATCTTGGAGAAGGGGATGTGCATTCTATGGTGTACCCGCCATCTGCCGCAAAGATGGCCTCTACTTTACCCAGTCTGTCTGAGATAAGCAATCCCGAAAACATGGAAAATCTTTTGGATAATCTCAACCTTCTCTCATCACCAACATCATTAACTGTTTCGACCCAGTCCTCACCTGGCACCATGATGCAGCAGACGCCGTGCTACTCGTTTGCGCCACCAAACACCAGTTTGAATTCACCCAGCCCAAACTACCAAAAATATACATATGGCCAATCCAGCATGAGCCCTTTGCCCCAGATGCCTATACAAACACTTCAGGACAATAAGTCGAGTTATGGAGGTATGAGTCAGTATAACTGTGCGCCTGGACTCTTGAAGGAGTTGCTGACTTCTGACTCTCCTCCCCATAATGACATTATGACACCAGTTGATCCTGGGGTAGCCCAGCCCAACAGCCGGGTTCTGGGCCAGAACGTCATGATGGGCCCTAATTCGGTCATGTCAACCTATGGCAGCCAGGCATCTCATAACAAAATGATGAATCCCAGCTCCCATACCCACCCTGGACATGCTCAGCAGACATCTGCAGTTAACGGGCGTCCCCTGCCCCACACGGTAAGCACCATGCCCCACACCTCGGGTATGAACCGCCTGACCCAAGTGAAGACACCTGTACAAGTGCCTCTGCCCCACCCCATGCAGATGAGTGCCCTGGGGGGCTACTCCTCCGTGAGCAGCTGCAATGGCTATGGCAGAATGGGCCTTCTCCACCAGGAGAAGCTCCCAAGTGACTTGGATGGCATGTTCATTGAGCGCTTAGACTGTGACATGGAATCCATCATTCGGAATGACCTCATGGATGGAGATACATTGGATTTTAACTTTGACAATGTGTTGCCCAACCAAAGCTTCCCACACAGTGTCAAGACAACGACACATAGCTGGGTGTCAGGCTGA

Back to List