Details for gene: MIR184


gene silencing by miRNA : Downregulation of gene expression through the action of microRNAs (miRNAs), endogenous 21-24 nucleotide small RNAs processed from stem-loop RNA precursors (pre-miRNAs). Once incorporated into a RNA-induced silencing complex (RISC), miRNAs can downregulate gene expression by either of two posttranscriptional mechanisms: endolytic cleavage of the RNA (often mRNA) or mRNA translational repression, usually accompanied by poly-A tail shortening and subsequent degradation of the mRNA. ;


Symbol
MIR184
Name
microRNA 184
Entrez ID
406960
Ensembl ID
ENSG00000207695    (more details)
KEGG ID
hsa:406960    (more details)
OMIM ID
613146
Uniprot ID
FALSE  
GO ID
hsa:406960    (more details)
Chromosome
6
Strand
1
Start
43770184
End
43786487
miRNA Interactions
Involved Diseases
Keratoconus /
Involved Pathways
Sequence
TGGACGGAGAACTGATAAGGGT

Back to List