Details for gene: NECTIN1


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; synapse : The junction between an axon of one neuron and a dendrite of another neuron, a muscle fiber or a glial cell. As the axon approaches the synapse it enlarges into a specialized structure, the presynaptic terminal bouton, which contains mitochondria and synaptic vesicles. At the tip of the terminal bouton is the presynaptic membrane; facing it, and separated from it by a minute cleft (the synaptic cleft) is a specialized area of membrane on the receiving cell, known as the postsynaptic membrane. In response to the arrival of nerve impulses, the presynaptic terminal bouton secretes molecules of neurotransmitters into the synaptic cleft. These diffuse across the cleft and transmit the signal to the postsynaptic membrane. ; cell-cell junction : A cell junction that forms a connection between two or more cells in a multicellular organism; excludes direct cytoplasmic intercellular bridges, such as ring canals in insects. ; cell adhesion molecule binding : Interacting selectively and non-covalently with a cell adhesion molecule. ; virion attachment to host cell : The process by which a virion protein binds to molecules on the host cellular surface or host cell surface projection. ; regulation of synapse assembly : Any process that modulates the frequency, rate or extent of synapse assembly, the aggregation, arrangement and bonding together of a set of components to form a synapse. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; adherens junction : A cell-cell junction composed of the epithelial cadherin-catenin complex. The epithelial cadherins, or E-cadherins, of each interacting cell extend through the plasma membrane into the extracellular space and bind to each other. The E-cadherins bind to catenins on the cytoplasmic side of the membrane, where the E-cadherin-catenin complex binds to cytoskeletal components and regulatory and signaling molecules. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; immune response : Any immune system process that functions in the calibrated response of an organism to a potential internal or invasive threat. ; cell-cell adhesion : The attachment of one cell to another cell via adhesion molecules. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; presynaptic membrane : A specialized area of membrane of the axon terminal that faces the plasma membrane of the neuron or muscle fiber with which the axon terminal establishes a synaptic junction; many synaptic junctions exhibit structural presynaptic characteristics, such as conical, electron-dense internal protrusions, that distinguish it from the remainder of the axon plasma membrane. ; viral entry into host cell : The process that occurs after viral attachment by which a virus, or viral nucleic acid, breaches the plasma membrane or cell envelope and enters the host cell. The process ends when the viral nucleic acid is released into the host cell cytoplasm. ; coreceptor activity : Combining with an extracellular or intracellular messenger, and in cooperation with a nearby primary receptor, initiating a change in cell activity. ; virus receptor activity : Combining with a virus component and mediating entry of the virus into the cell. ; homophilic cell adhesion via plasma membrane adhesion molecules : The attachment of a plasma membrane adhesion molecule in one cell to an identical molecule in an adjacent cell. ; heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules : The attachment of an adhesion molecule in one cell to a nonidentical adhesion molecule in an adjacent cell. ; protein localization to cell junction : A process in which a protein is transported to, or maintained in, a location within a cell junction. ; carbohydrate binding : Interacting selectively and non-covalently with any carbohydrate, which includes monosaccharides, oligosaccharides and polysaccharides as well as substances derived from monosaccharides by reduction of the carbonyl group (alditols), by oxidation of one or more hydroxy groups to afford the corresponding aldehydes, ketones, or carboxylic acids, or by replacement of one or more hydroxy group(s) by a hydrogen atom. Cyclitols are generally not regarded as carbohydrates. ; signaling receptor activity : Receiving a signal and transmitting it in the cell to initiate a change in cell activity. A signal is a physical entity or change in state that is used to transfer information in order to trigger a response. ; protein-containing complex binding : Interacting selectively and non-covalently with a macromolecular complex. ; virion binding : Interacting selectively and non-covalently with a virion, either by binding to components of the capsid or the viral envelope. ; lens morphogenesis in camera-type eye : The process in which the anatomical structures of the lens are generated and organized. The lens is a transparent structure in the eye through which light is focused onto the retina. An example of this process is found in Mus musculus. ; desmosome organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a desmosome. A desmosome is a patch-like intercellular junction found in vertebrate tissues, consisting of parallel zones of two cell membranes, separated by an space of 25-35 nm, and having dense fibrillar plaques in the subjacent cytoplasm. ; iron ion transport : The directed movement of iron (Fe) ions into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; axon guidance : The chemotaxis process that directs the migration of an axon growth cone to a specific target site in response to a combination of attractive and repulsive cues. ; camera-type eye morphogenesis : The process in which the anatomical structures of the eye are generated and organized. The camera-type eye is an organ of sight that receives light through an aperture and focuses it through a lens, projecting it on a photoreceptor field. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; enamel mineralization : The process in which calcium salts, mainly carbonated hydroxyapatite, are deposited in tooth enamel. ; axon : The long process of a neuron that conducts nerve impulses, usually away from the cell body to the terminals and varicosities, which are sites of storage and release of neurotransmitter. ; dendrite : A neuron projection that has a short, tapering, morphology. Dendrites receive and integrate signals from other neurons or from sensory stimuli, and conduct nerve impulses towards the axon or the cell body. In most neurons, the impulse is conveyed from dendrites to axon via the cell body, but in some types of unipolar neuron, the impulse does not travel via the cell body. ; growth cone membrane : The portion of the plasma membrane surrounding a growth cone. ; neuron projection : A prolongation or process extending from a nerve cell, e.g. an axon or dendrite. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; apical junction complex : A functional unit located near the cell apex at the points of contact between epithelial cells, which in vertebrates is composed of the tight junction, the zonula adherens, and desmosomes and in some invertebrates, such as Drosophila, is composed of the subapical complex (SAC), the zonula adherens and the septate junction. Functions in the regulation of cell polarity, tissue integrity and intercellular adhesion and permeability. ; cell-cell contact zone : Extended zone of intimate apposition between two cells containing one or more types of intercellular junctions, e.g., the intercalated disk of muscle. ; hippocampal mossy fiber to CA3 synapse : One of the giant synapses that form between the mossy fiber axons of dentate gyrus granule cells and the large complex spines of CA3 pyramidal cells. It consists of a giant bouton known as the mossy fiber expansion, synapsed to the complex, multiheaded spine (thorny excresence) of a CA3 pyramidal cell. ; integral component of presynaptic active zone membrane : The component of the presynaptic active zone membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ;


Symbol
NECTIN1
Name
nectin cell adhesion molecule 1
Entrez ID
5818
Ensembl ID
ENSG00000110400    (more details)
KEGG ID
hsa:5818    (more details)
OMIM ID
225060
Uniprot ID
Q15223  
GO ID
hsa:5818    (more details)
Chromosome
20
Strand
-1
Start
25070885
End
25082141
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-765 (RPM: 0.4272) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-2-5p (RPM: 0.387) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-4731-5p (RPM: 0.185) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-449a (RPM: 1.3118) / hsa-miR-762 (RPM: 0.04) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-214-3p (RPM: 21.2784) / hsa-miR-3150a-3p (RPM: 0.0248) / hsa-miR-4498 (RPM: 0.1118) / hsa-miR-214-5p (RPM: 5.1378) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-412-3p (RPM: 0.02) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-4492 (RPM: 1.8706) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-5001-5p (RPM: 0.22) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-185-3p (RPM: 4.0636) / hsa-miR-3179 (RPM: 0.0296) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-4505 (RPM: 0.004) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-4667-5p (RPM: 0.2964) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-3175 (RPM: 0.2046) / hsa-miR-124-5p (RPM: 23.3116) / hsa-miR-24-2-5p (RPM: 18.574) / hsa-miR-24-1-5p (RPM: 3.1364) / hsa-miR-4749-5p (RPM: 0.337) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6825-5p (RPM: 0.261) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-5787 (RPM: 0.0012) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-6763-5p (RPM: 0.1166) / hsa-miR-6858-5p (RPM: 0.2032) / hsa-miR-6813-5p (RPM: 0.011) / hsa-miR-1343-5p (RPM: 0.0198) / hsa-miR-4706 (RPM: 0.1162) / hsa-miR-6777-5p (RPM: 0.557) / hsa-miR-6889-5p (RPM: 0.041) /
Involved Diseases
Herpes simplex virus /
Involved Pathways
Cell adhesion molecules (CAMs) / Adherens junction /
Sequence
ATGGCTCGGATGGGGCTTGCGGGCGCCGCTGGACGCTGGTGGGGACTCGCTCTCGGCTTGACCGCATTCTTCCTCCCAGGCGTCCACTCCCAGGTGGTCCAGGTGAACGACTCCATGTATGGCTTCATCGGCACAGACGTGGTTCTGCACTGCAGCTTTGCCAACCCGCTTCCCAGCGTGAAGATCACCCAGGTCACATGGCAGAAGTCCACCAATGGCTCCAAGCAGAACGTGGCCATCTACAACCCATCCATGGGCGTGTCCGTGCTGGCTCCCTACCGCGAGCGTGTGGAATTCCTGCGGCCCTCCTTCACCGATGGCACTATCCGCCTCTCCCGCCTGGAGCTGGAGGATGAGGGTGTCTACATCTGCGAGTTTGCTACCTTCCCTACGGGCAATCGAGAAAGCCAGCTCAATCTCACGGTGATGGCCAAACCCACCAATTGGATAGAGGGTACCCAGGCAGTGCTTCGAGCCAAGAAGGGGCAGGATGACAAGGTCCTGGTGGCCACCTGCACCTCAGCCAATGGGAAGCCTCCCAGTGTGGTATCCTGGGAAACTCGGTTAAAAGGTGAGGCAGAGTACCAGGAGATCCGGAACCCCAATGGCACAGTGACGGTCATCAGCCGCTACCGCCTGGTGCCCAGCAGGGAAGCCCACCAGCAGTCCTTGGCCTGCATCGTCAACTACCACATGGACCGCTTCAAGGAAAGCCTCACTCTCAACGTGCAGTATGAGCCTGAGGTAACCATTGAGGGGTTTGATGGCAACTGGTACCTGCAGCGGATGGACGTGAAGCTCACCTGCAAAGCTGATGCTAACCCCCCAGCCACTGAGTACCACTGGACCACGCTAAATGGCTCTCTCCCCAAGGGTGTGGAGGCCCAGAACAGAACCCTCTTCTTCAAGGGACCCATCAACTACAGCCTGGCAGGGACCTACATCTGTGAGGCCACCAACCCCATCGGTACACGCTCAGGCCAGGTGGAGGTCAATATCACAGAATTCCCCTACACCCCGTCTCCTCCCGAACATGGGCGGCGCGCCGGGCCGGTGCCCACGGCCATCATTGGGGGCGTGGCGGGGAGCATCCTGCTGGTGTTGATTGTGGTCGGCGGGATCGTGGTCGCCCTGCGTCGGCGCCGGCACACCTTCAAGGGTGACTACAGCACCAAGAAGCACGTGTATGGCAACGGCTACAGCAAGGCAGGCATCCCCCAGCACCACCCACCAATGGCACAGAACCTGCAGTACCCCGACGACTCAGACGACGAGAAGAAGGCCGGCCCACTGGGTGGAAGCAGCTATGAGGAGGAGGAGGAGGAGGAGGAGGGCGGTGGAGGGGGCGAGCGCAAGGTGGGCGGCCCCCACCCCAAATATGACGAGGACGCCAAGCGGCCCTACTTCACCGTGGATGAGGCCGAGGCCCGTCAGGACGGCTACGGGGACCGGACTCTGGGCTACCAGTACGACCCTGAGCAGCTGGACTTGGCTGAGAACATGGTTTCTCAGAACGACGGGTCTTTCATTTCCAAGAAGGAGTGGTACGTGTAG

Back to List