Details for gene: NECTIN2


cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; spermatid development : The process whose specific outcome is the progression of a spermatid over time, from its formation to the mature structure. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; cell-cell junction : A cell junction that forms a connection between two or more cells in a multicellular organism; excludes direct cytoplasmic intercellular bridges, such as ring canals in insects. ; cell adhesion molecule binding : Interacting selectively and non-covalently with a cell adhesion molecule. ; virion attachment to host cell : The process by which a virion protein binds to molecules on the host cellular surface or host cell surface projection. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; focal adhesion : A cell-substrate junction that anchors the cell to the extracellular matrix and that forms a point of termination of actin filaments. In insects focal adhesion has also been referred to as hemi-adherens junction (HAJ). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; regulation of viral entry into host cell : Any process that modulates the frequency, rate or extent of the viral entry into the host cell. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; cytoskeleton organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures. ; positive regulation of T cell receptor signaling pathway : Any process that activates or increases the frequency, rate or extent of signaling pathways initiated by the cross-linking of an antigen receptor on a T cell. ; apical junction complex : A functional unit located near the cell apex at the points of contact between epithelial cells, which in vertebrates is composed of the tight junction, the zonula adherens, and desmosomes and in some invertebrates, such as Drosophila, is composed of the subapical complex (SAC), the zonula adherens and the septate junction. Functions in the regulation of cell polarity, tissue integrity and intercellular adhesion and permeability. ; cell surface : The external part of the cell wall and/or plasma membrane. ; coreceptor activity : Combining with an extracellular or intracellular messenger, and in cooperation with a nearby primary receptor, initiating a change in cell activity. ; positive regulation of natural killer cell mediated cytotoxicity : Any process that activates or increases the frequency, rate or extent of natural killer cell mediated cytotoxicity. ; virus receptor activity : Combining with a virus component and mediating entry of the virus into the cell. ; homophilic cell adhesion via plasma membrane adhesion molecules : The attachment of a plasma membrane adhesion molecule in one cell to an identical molecule in an adjacent cell. ; positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target : Any process that activates or increases the frequency, rate, or extent of natural killer cell mediated cytotoxicity directed against tumor cell target. ; adhesion of symbiont to host : The attachment of a symbiont to its host via adhesion molecules, general stickiness etc., either directly or indirectly. The host is defined as the larger of the organisms involved in a symbiotic interaction. ; zonula adherens : A cell-cell adherens junction which forms a continuous belt near the apex of epithelial cells. ; susceptibility to natural killer cell mediated cytotoxicity : The process of causing a cell to become susceptible to natural killer cell mediated cytotoxicity. ; susceptibility to T cell mediated cytotoxicity : The process of causing a cell to become susceptible to T cell mediated cytotoxicity. ; positive regulation of immunoglobulin mediated immune response : Any process that activates or increases the frequency, rate, or extent of an immunoglobulin mediated immune response. ; positive regulation of mast cell activation : Any process that activates or increases the frequency, rate, or extent of mast cell activation. ; acrosome assembly : The formation of the acrosome from the spermatid Golgi. ; fusion of virus membrane with host plasma membrane : Fusion of a viral membrane with the host cell membrane during viral entry. Results in release of the virion contents into the cytoplasm. ; coreceptor-mediated virion attachment to host cell : The process by which a virion attaches to a host cell by binding to a co-receptor on the host cell surface. ; establishment of mitochondrion localization : The directed movement of the mitochondrion to a specific location. ; spermatid nucleus differentiation : The specialization of the spermatid nucleus during the development of a spermatid into a mature male gamete competent for fertilization. ; fertilization : The union of gametes of opposite sexes during the process of sexual reproduction to form a zygote. It involves the fusion of the gametic nuclei (karyogamy) and cytoplasm (plasmogamy). ; sperm mitochondrion organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of sperm mitochondria; the process in which they take on their characteristic morphology; they are flattened, elongated, and arranged circumferentially into a tight helical coil around the tail-dense fibers of the mature sperm. ; cell part morphogenesis : The process in which the anatomical structures of a cell part are generated and organized. ; cilium organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell-cell contact zone : Extended zone of intimate apposition between two cells containing one or more types of intercellular junctions, e.g., the intercalated disk of muscle. ;


Symbol
NECTIN2
Name
nectin cell adhesion molecule 2
Entrez ID
5819
Ensembl ID
ENSG00000130202    (more details)
KEGG ID
hsa:5819    (more details)
OMIM ID
600798
Uniprot ID
Q92692  
GO ID
hsa:5819    (more details)
Chromosome
7
Strand
1
Start
16916359
End
17346152
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-7-5p (RPM: 19.3682) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1229-3p (RPM: 1.3764) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-26b-3p (RPM: 23.5016) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-1913 (RPM: 0.4166) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Herpes simplex virus /
Involved Pathways
Herpes simplex infection /
Sequence
ATGGCCCGGGCCGCTGCCCTCCTGCCGTCGAGATCGCCGCCGACGCCGCTGCTGTGGCCGCTGCTGCTGCTGCTGCTCCTGGAAACCGGAGCCCAGGATGTGCGAGTTCAAGTGCTACCCGAGGTGCGAGGCCAGCTCGGGGGCACCGTGGAGCTGCCGTGCCACCTGCTGCCACCTGTTCCTGGACTGTACATCTCCCTGGTGACCTGGCAGCGCCCAGATGCACCTGCGAACCACCAGAATGTGGCCGCCTTCCACCCTAAGATGGGTCCCAGCTTCCCCAGCCCGAAGCCTGGCAGCGAGCGGCTGTCCTTCGTCTCTGCCAAGCAGAGCACTGGGCAAGACACAGAGGCAGAGCTCCAGGACGCCACGCTGGCCCTCCACGGGCTCACGGTGGAGGACGAGGGCAACTACACTTGCGAGTTTGCCACCTTCCCCAAGGGGTCCGTCCGAGGGATGACCTGGCTCAGAGTCATAGCCAAGCCCAAGAACCAAGCTGAGGCCCAGAAGGTCACGTTCAGCCAGGACCCTACGACAGTGGCCCTCTGCATCTCCAAAGAGGGCCGCCCACCTGCCCGGATCTCCTGGCTCTCATCCCTGGACTGGGAAGCCAAAGAGACTCAGGTGTCAGGGACCCTGGCCGGAACTGTCACTGTCACCAGCCGCTTCACCTTGGTGCCCTCGGGCCGAGCAGATGGTGTCACGGTCACCTGCAAAGTGGAGCATGAGAGCTTCGAGGAACCAGCCCTGATACCTGTGACCCTCTCTGTACGCTACCCTCCTGAAGTGTCCATCTCCGGCTATGATGACAACTGGTACCTCGGCCGTACTGATGCCACCCTGAGCTGTGACGTCCGCAGCAACCCAGAGCCCACGGGCTATGACTGGAGCACGACCTCAGGCACCTTCCCGACCTCCGCAGTGGCCCAGGGCTCCCAGCTGGTCATCCACGCAGTGGACAGTCTGTTCAATACCACCTTCGTCTGCACAGTCACCAATGCCGTGGGCATGGGCCGCGCTGAGCAGGTCATCTTTGTCCGAGAGACCCCCAACACAGCAGGCGCAGGGGCCACAGGCGGCATCATCGGGGGCATCATCGCCGCCATCATTGCTACTGCTGTGGCTGCCACGGGCATCCTTATCTGCCGGCAGCAGCGGAAGGAGCAGACGCTGCAGGGGGCAGAGGAGGACGAAGACCTGGAGGGACCTCCCTCCTACAAGCCACCGACCCCAAAAGCGAAGCTGGAGGCACAGGAGATGCCCTCCCAGCTCTTCACTCTGGGGGCCTCGGAGCACAGCCCACTCAAGACCCCCTACTTTGATGCTGGCGCCTCATGCACTGAGCAGGAAATGCCTCGATACCATGAGCTGCCCACCTTGGAAGAACGGTCAGGACCCTTGCACCCTGGAGCCACAAGCCTGGGGTCCCCCATCCCGGTGCCTCCAGGGCCACCTGCTGTGGAAGACGTTTCCCTGGATCTAGAGGATGAGGAGGGGGAGGAGGAGGAAGAGTATCTGGACAAGATCAACCCCATCTATGATGCTCTGTCCTATAGCAGCCCCTCTGATTCCTACCAGGGCAAAGGCTTTGTCATGTCCCGGGCCATGTATGTGTGA

Back to List