Details for gene: ARL3


GTP binding : Interacting selectively and non-covalently with GTP, guanosine triphosphate. ; GTPase activity : Catalysis of the reaction: GTP + H2O = GDP + phosphate. ; positive regulation of microtubule polymerization : Any process that activates or increases the frequency, rate or extent of microtubule polymerization. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell division : The process resulting in division and partitioning of components of a cell to form more cells; may or may not be accompanied by the physical separation of a cell into distinct, individually membrane-bounded daughter cells. ; Golgi to plasma membrane transport : The directed movement of substances from the Golgi to the plasma membrane in transport vesicles that move from the trans-Golgi network to the plasma membrane, where they fuse and release their contents by exocytosis. ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cell cycle : The progression of biochemical and morphological phases and events that occur in a cell during successive cell replication or nuclear replication events. Canonically, the cell cycle comprises the replication and segregation of genetic material followed by the division of the cell, but in endocycles or syncytial cells nuclear replication or nuclear division may not be followed by cell division. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; spindle : The array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during mitosis or meiosis and serves to move the duplicated chromosomes apart. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ; kidney development : The process whose specific outcome is the progression of the kidney over time, from its formation to the mature structure. The kidney is an organ that filters the blood and/or excretes the end products of body metabolism in the form of urine. ; microtubule binding : Interacting selectively and non-covalently with microtubules, filaments composed of tubulin monomers. ; protein localization to cilium : A process in which a protein is transported to, or maintained in, a location within a cilium. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; spindle microtubule : Any microtubule that is part of a mitotic or meiotic spindle; anchored at one spindle pole. ; GDP binding : Interacting selectively and non-covalently with GDP, guanosine 5'-diphosphate. ; mitotic cytokinesis : A cell cycle process that results in the division of the cytoplasm of a cell after mitosis, resulting in the separation of the original cell into two daughter cells. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ; cytoplasmic microtubule : Any microtubule in the cytoplasm of a cell. ; post-Golgi vesicle-mediated transport : The directed movement of substances from the Golgi to other parts of the cell, including organelles and the plasma membrane, mediated by small transport vesicles. ; small GTPase mediated signal transduction : Any series of molecular signals in which a small monomeric GTPase relays one or more of the signals. ; magnesium ion binding : Interacting selectively and non-covalently with magnesium (Mg) ions. ; GTPase activating protein binding : Interacting selectively and non-covalently with a GTPase activating protein. ; smoothened signaling pathway : A series of molecular signals generated as a consequence of activation of the transmembrane protein Smoothened. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; photoreceptor cell development : Development of a photoreceptor, a cell that responds to incident electromagnetic radiation, particularly visible light. ; protein localization to ciliary membrane : A process in which a protein is transported to, or maintained in, a location within a ciliary membrane. ;


Symbol
ARL3
Name
ADP ribosylation factor like GTPase 3
Entrez ID
403
Ensembl ID
ENSG00000138175    (more details)
KEGG ID
hsa:403    (more details)
OMIM ID
604695
Uniprot ID
P36405  
GO ID
hsa:403    (more details)
Chromosome
11
Strand
-1
Start
66510606
End
66533613
miRNA Interactions
hsa-miR-133a-3p (RPM: 411.6588) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-4660 (RPM: 0.1994) / hsa-miR-103a-2-5p (RPM: 0.387) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-607 (RPM: 0.001) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-4429 (RPM: 0.0238) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-33b-5p (RPM: 5.2366) / hsa-miR-4680-5p (RPM: 0.061) / hsa-miR-512-5p (RPM: 0.0024) / hsa-miR-6875-3p (RPM: 0.0698) / hsa-miR-6780a-3p (RPM: 0.023) / hsa-miR-6881-3p (RPM: 0.2412) / hsa-miR-6736-3p (RPM: 0.0064) / hsa-miR-7111-3p (RPM: 0.0388) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Trafficking of myristoylated proteins to the cilium /
Sequence
ATGGGCTTGCTCTCAATTTTGCGCAAGTTGAAAAGTGCACCAGACCAGGAGGTGAGAATACTTCTCCTGGGCTTGGATAATGCTGGCAAGACCACTCTTCTGAAGCAGCTTGCATCTGAAGACATCAGCCACATCACACCTACACAGGGTTTCAACATCAAAAGTGTACAATCACAAGGTTTTAAACTGAATGTATGGGACATTGGTGGACAGAGGAAAATCAGACCATACTGGAAGAATTATTTTGAAAATACCGATATTCTTATATATGTAATCGACAGTGCAGACAGAAAAAGATTTGAAGAGACGGGTCAGGAACTAGCGGAATTACTGGAGGAAGAAAAACTAAGTTGTGTGCCAGTGCTCATCTTTGCTAATAAGCAGGATTTGCTCACAGCAGCCCCTGCCTCTGAAATTGCAGAAGGACTGAACCTGCATACCATCCGCGACCGAGTCTGGCAGATCCAGTCTTGCTCAGCTCTCACAGGAGAGGGCGTTCAGGATGGCATGAACTGGGTCTGCAAAAATGTCAATGCAAAGAAGAAATAA

Back to List