Details for gene: BBS1


BBSome : A ciliary protein complex involved in cilium biogenesis. It consists of at least seven Bardet-Biedl syndrome (BBS) proteins and BBIP10. It moves in association with IFT trains through cilia (likely as an IFT-A/B adaptor or cargo), and is required for the integrity of IFT-A and IFT-B. ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; ciliary membrane : The portion of the plasma membrane surrounding a cilium. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; sensory perception of smell : The series of events required for an organism to receive an olfactory stimulus, convert it to a molecular signal, and recognize and characterize the signal. Olfaction involves the detection of chemical composition of an organism's ambient medium by chemoreceptors. This is a neurological process. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; protein localization to cilium : A process in which a protein is transported to, or maintained in, a location within a cilium. ; patched binding : Interacting selectively and non-covalently with the patched (ptc) protein, a receptor for hedgehog proteins. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; RNA polymerase II-specific DNA-binding transcription factor binding : Interacting selectively and non-covalently with a sequence-specific DNA binding RNA polymerase II transcription factor, any of the factors that interact selectively and non-covalently with a specific DNA sequence in order to modulate transcription. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; smoothened binding : Interacting selectively and non-covalently with the smoothened (smo) protein, which interacts with patched to transmit hedgehog signals. ; Golgi to plasma membrane protein transport : The directed movement of proteins from the Golgi to the plasma membrane in transport vesicles that move from the trans-Golgi network to the plasma membrane. ;


Symbol
BBS1
Name
Bardet-Biedl syndrome 1
Entrez ID
582
Ensembl ID
ENSG00000174483    (more details)
KEGG ID
hsa:582    (more details)
OMIM ID
209900
Uniprot ID
Q8NFJ9  
GO ID
hsa:582    (more details)
Chromosome
16
Strand
1
Start
56465640
End
56582667
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-4731-5p (RPM: 0.185) / hsa-miR-452-5p (RPM: 23.696) / hsa-miR-203b-3p (RPM: 3.2494) / hsa-miR-5002-3p (RPM: 0.0164) / hsa-miR-3132 (RPM: 0.0192) / hsa-miR-5589-5p (RPM: 0.0034) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-134-5p (RPM: 29.8712) / hsa-miR-197-5p (RPM: 0.5912) / hsa-miR-1229-5p (RPM: 0.01) / hsa-miR-6861-5p (RPM: 0.0164) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
BBSome-mediated cargo-targeting to cilium /
Sequence
ATGGCCGCTGCGTCCTCATCGGATTCCGACGCCTGCGGAGCTGAGAGCAATGAGGCCAATTCGAAGTGGTTGGATGCGCACTACGACCCAATGGCCAATATCCACACCTTTTCTGCCTGCCTAGCGCTGGCAGATTTACATGGGGATGGGGAATACAAGCTGGTGGTAGGGGACCTTGGCCCTGGTGGGCAGCAGCCCCGCCTGAAGGTGCTCAAAGGACCACTGGTGATGACCGAAAGCCCGCTACCTGCTCTGCCAGCTGCTGCTGCCACCTTCCTCATGGAGCAACATGAGCCCCGGACCCCAGCTCTGGCACTTGCTTCAGGCCCTTGTGTCTATGTGTATAAGAATCTCAGACCCTACTTCAAGTTCAGCCTGCCCCAATTGCCTCCAAATCCTCTGGAACAAGACCTTTGGAACCAGGCCAAAGAGGACCGAATCGACCCCTTAACCCTGAAGGAGATGCTGGAGAGCATCCGGGAGACGGCAGAGGAGCCTTTGTCCATCCAGTCACTCAGGTTTCTGCAGCTGGAGCTAAGTGAAATGGAGGCATTTGTAAACCAACACAAGTCCAACTCCATCAAGCGGCAGACAGTCATCACCACCATGACCACCTTGAAGAAGAACCTGGCTGACGAGGATGCTGTGTCTTGCCTGGTGCTGGGCACCGAGAACAAGGAGCTCCTGGTGCTTGACCCCGAGGCCTTCACCATTTTAGCCAAGATGAGCCTTCCCAGCGTCCCCGTCTTCCTAGAGGTTTCTGGCCAGTTTGATGTTGAGTTCCGGCTTGCCGCGGCCTGCCGCAATGGAAACATCTATATTCTGAGAAGAGACTCCAAGCACCCCAAGTACTGCATCGAGCTGAGCGCCCAGCCTGTGGGACTTATCCGGGTACACAAGGTCCTAGTGGTGGGCAGCACCCAAGACAGCCTGCATGGCTTCACCCACAAGGGGAAGAAGCTGTGGACAGTGCAGATGCCCGCAGCCATCCTGACCATGAACCTCCTGGAGCAGCATTCCCGGGGCCTGCAGGCCGTCATGGCTGGGCTGGCCAATGGAGAGGTCCGCATTTATCGTGACAAGGCCCTGCTCAATGTCATCCACACCCCGGATGCAGTGACCAGCCTTTGCTTTGGCCGGTACGGGCGGGAGGACAACACCCTCATCATGACCACTCGAGGTGGTGGCCTGATCATCAAGATCCTGAAGCGTACAGCAGTGTTTGTAGAGGGAGGAAGTGAGGTGGGTCCCCCACCAGCCCAGGCCATGAAACTCAATGTGCCCCGAAAGACCCGGCTTTACGTGGATCAGACACTGCGAGAGCGGGAGGCTGGCACCGCCATGCACCGGGCCTTCCAGACAGACCTATACCTGCTGCGCCTACGTGCTGCCCGCGCCTACCTGCAGGCCCTCGAGTCCAGCCTGAGCCCCCTGTCCACGACAGCCCGAGAGCCACTCAAGCTGCACGCCGTGGTTCAGGGCCTTGGCCCCACCTTTAAGCTCACACTTCACCTGCAGAACACCTCAACAACCCGTCCTGTCCTGGGGCTGCTGGTCTGCTTCCTGTACAACGAGGCGCTCTATTCCCTGCCCCGGGCCTTCTTCAAGGTACCCTTGCTGGTGCCAGGGCTCAACTACCCCCTGGAGACCTTTGTGGAGAGTCTCAGTAACAAGGGCATCTCAGACATCATCAAGGTGCTGGTGCTTCGAGAAGGCCAAAGTGCACCCCTGCTGAGTGCCCACGTCAACATGCCTGGGAGCGAGGGGCTGGCGGCCGCCTGA

Back to List