Details for gene: BBS2


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; BBSome : A ciliary protein complex involved in cilium biogenesis. It consists of at least seven Bardet-Biedl syndrome (BBS) proteins and BBIP10. It moves in association with IFT trains through cilia (likely as an IFT-A/B adaptor or cargo), and is required for the integrity of IFT-A and IFT-B. ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; ciliary membrane : The portion of the plasma membrane surrounding a cilium. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; neuron projection : A prolongation or process extending from a nerve cell, e.g. an axon or dendrite. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; motile cilium : A cilium which may have a variable arrangement of axonemal microtubules and also contains molecular motors. It may beat with a whip-like pattern that promotes cell motility or transport of fluids and other cells across a cell surface, such as on epithelial cells that line the lumenal ducts of various tissues; or they may display a distinct twirling motion that directs fluid flow asymmetrically across the cellular surface to affect asymmetric body plan organization. Motile cilia can be found in single as well as multiple copies per cell. ; cerebral cortex development : The progression of the cerebral cortex over time from its initial formation until its mature state. The cerebral cortex is the outer layered region of the telencephalon. ; fat cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of an adipocyte, an animal connective tissue cell specialized for the synthesis and storage of fat. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; protein localization : Any process in which a protein is transported to, or maintained in, a specific location. ; brain morphogenesis : The process in which the anatomical structures of the brain are generated and organized. The brain is one of the two components of the central nervous system and is the center of thought and emotion. It is responsible for the coordination and control of bodily activities and the interpretation of information from the senses (sight, hearing, smell, etc.). ; RNA polymerase II-specific DNA-binding transcription factor binding : Interacting selectively and non-covalently with a sequence-specific DNA binding RNA polymerase II transcription factor, any of the factors that interact selectively and non-covalently with a specific DNA sequence in order to modulate transcription. ; hippocampus development : The progression of the hippocampus over time from its initial formation until its mature state. ; protein localization to organelle : A process in which a protein is transported to, or maintained in, a location within an organelle. ; adult behavior : Behavior in a fully developed and mature organism. ; melanosome transport : The directed movement of melanosomes into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; Golgi to plasma membrane protein transport : The directed movement of proteins from the Golgi to the plasma membrane in transport vesicles that move from the trans-Golgi network to the plasma membrane. ; striatum development : The progression of the striatum over time from its initial formation until its mature state. The striatum is a region of the forebrain consisting of the caudate nucleus, putamen and fundus striati. ; negative regulation of appetite by leptin-mediated signaling pathway : A series of molecular signals initiated by the binding of leptin to a receptor on the surface of a cell, which reduces appetite, the desire or physical craving for food. ; regulation of cilium beat frequency involved in ciliary motility : Any process that modulates the frequency of cilium beating involved in ciliary motility. ; sperm axoneme assembly : The assembly and organization of the sperm flagellar axoneme, the bundle of microtubules and associated proteins that forms the core of the eukaryotic sperm flagellum, and is responsible for movement. ; negative regulation of multicellular organism growth : Any process that stops, prevents, or reduces the frequency, rate or extent of growth of an organism to reach its usual body size. ;


Symbol
BBS2
Name
Bardet-Biedl syndrome 2
Entrez ID
583
Ensembl ID
ENSG00000125124    (more details)
KEGG ID
hsa:583    (more details)
OMIM ID
606151
Uniprot ID
Q9BXC9  
GO ID
hsa:583    (more details)
Chromosome
17
Strand
-1
Start
60149942
End
60170899
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-194-5p (RPM: 48.9448) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-2355-5p (RPM: 2.178) / hsa-miR-433-3p (RPM: 9.0888) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-1914-3p (RPM: 0.0102) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
BBSome-mediated cargo-targeting to cilium /
Sequence
ATGCTGCTGCCTGTGTTCACCCTGAAACTGCGCCACAAAATCAGCCCCCGAATGGTGGCCATAGGGCGCTACGACGGGACTCACCCGTGCCTGGCGGCCGCCACCCAAACGGGCAAGGTTTTTATTCATAATCCTCATACACGGAACCAGCATGTCAGTGCATCCAGGGTCTTCCAGAGCCCCCTGGAATCTGATGTTTCTCTTCTCAGCATTAACCAGGCAGTCAGCTGTCTGACTGCAGGCGTATTGAACCCTGAGCTTGGCTATGATGCCCTTTTAGTGGGGACACAGACTAATCTTTTGGCTTATGATGTCTACAATAATTCGGATTTGTTCTACAGAGAGGTAGCAGATGGGGCAAATGCAATTGTGCTGGGGACATTGGGAGACATTTCTTCCCCTCTTGCGATTATTGGTGGCAATTGTGCTCTGCAAGGTTTCAATCATGAAGGAAGTGATCTCTTTTGGACGGTTACTGGAGACAATGTTAATTCCTTGGCCTTGTGTGACTTTGATGGTGATGGAAAGAAAGAGCTTCTTGTTGGATCTGAGGATTTTGATATCCGAGTTTTTAAGGAAGATGAGATTGTGGCAGAAATGACAGAAACAGAGATAGTCACCTCTCTTTGTCCCATGTATGGCAGTCGATTTGGTTATGCCCTTTCCAATGGCACAGTTGGAGTTTATGACAAAACATCCCGATACTGGAGAATTAAATCGAAAAATCATGCCATGAGCATTCATGCTTTTGACCTTAATTCTGATGGAGTGAATGAACTGATAACTGGTTGGTCCAATGGGAAGGTTGATGCTCGAAGTGACCGAACTGGGGAGGTCATCTTTAAGGACAATTTTTCTTCTGCAATTGCCGGTGTGGTAGAGGGAGATTACCGGATGGATGGCCACATACAGTTAATCTGCTGCTCAGTGGATGGGGAAATCCGGGGCTACCTGCCTGGCACGGCTGAGATGAGGGGCAACCTCATGGACACCAGTGCAGAGCAGGACCTGATCCGAGAGCTGAGTCAGAAGAAGCAGAATCTGTTGCTGGAACTCCGTAACTATGAGGAAAATGCCAAGGCTGAATTGGCCAGTCCACTGAACGAGGCTGATGGGCATCGGGGCATAATCCCAGCCAATACCAGGCTCCACACCACGCTCTCAGTCAGCCTGGGGAATGAGACCCAAACTGCTCATACAGAATTACGCATTTCCACTTCTAATGACACCATCATCCGAGCAGTATTGATTTTTGCAGAAGGAATTTTTACAGGTGAAAGCCACGTGGTACATCCCAGCATTCACAACCTCTCCAGTTCCATCTGCATCCCTATTGTGCCTCCCAAAGATGTCCCTGTGGATCTGCACTTGAAGGCATTCGTGGGTTACAGAAGCAGCACCCAGTTTCATGTATTTGAATCGACAAGACAGCTCCCTCGATTCTCCATGTATGCGCTGACCAGCCTGGACCCTGCCAGTGAGCCAATCAGTTATGTTAACTTTACCATTGCAGAACGGGCACAGAGGGTTGTTGTATGGCTCGGTCAGAACTTTCTGTTACCAGAAGACACTCACATTCAGAATGCTCCATTTCAAGTGTGTTTCACATCTTTACGGAATGGCGGCCACCTGCATATAAAAATAAAACTTAGTGGAGAGATCACTATAAATACTGATGATATTGATTTGGCTGGTGATATCATCCAGTCAATGGCATCATTTTTTGCTATTGAAGACCTTCAAGTAGAAGCGGATTTTCCTGTCTATTTTGAGGAATTACGAAAGGTGCTAGTTAAGGTGGATGAATATCATTCAGTGCATCAGAAGCTCAGTGCTGATATGGCTGATCATTCTAATTTGATCCGAAGTTTGCTGGTCGGAGCTGAGGATGCTCGTCTGATGAGGGACATGAAAACAATGAAGAGTCGTTATATGGAACTCTATGACCTTAATAGAGACTTGCTAAATGGATATAAAATTCGCTGTAACAATCACACAGAGCTGTTGGGAAACCTCAAAGCAGTAAATCAAGCAATTCAAAGAGCAGGTCGTCTGCGGGTTGGAAAACCAAAGAACCAGGTGATCACTGCTTGTCGGGATGCAATTCGAAGCAATAACATCAACACACTGTTCAAAATCATGCGAGTGGGGACAGCTTCTTCCTAG

Back to List