Details for gene: CA4


zinc ion binding : Interacting selectively and non-covalently with zinc (Zn) ions. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; carbonate dehydratase activity : Catalysis of the reaction: H2CO3 = CO2 + H2O. ; anchored component of membrane : The component of a membrane consisting of the gene products that are tethered to the membrane only by a covalently attached anchor, such as a lipid group that is embedded in the membrane. Gene products with peptide sequences that are embedded in the membrane are excluded from this grouping. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; lyase activity : Catalysis of the cleavage of C-C, C-O, C-N and other bonds by other means than by hydrolysis or oxidation, or conversely adding a group to a double bond. They differ from other enzymes in that two substrates are involved in one reaction direction, but only one in the other direction. When acting on the single substrate, a molecule is eliminated and this generates either a new double bond or a new ring. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; cell surface : The external part of the cell wall and/or plasma membrane. ; hydro-lyase activity : Catalysis of the cleavage of a carbon-oxygen bond by elimination of water. ; one-carbon metabolic process : The chemical reactions and pathways involving the transfer of one-carbon units in various oxidation states. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; bicarbonate transport : The directed movement of bicarbonate into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; rough endoplasmic reticulum : The rough (or granular) endoplasmic reticulum (ER) has ribosomes adhering to the outer surface; the ribosomes are the site of translation of the mRNA for those proteins which are either to be retained within the cisternae (ER-resident proteins), the proteins of the lysosomes, or the proteins destined for export from the cell. Glycoproteins undergo their initial glycosylation within the cisternae. ; endoplasmic reticulum-Golgi intermediate compartment : A complex system of membrane-bounded compartments located between endoplasmic reticulum (ER) and the Golgi complex, with a distinctive membrane protein composition; involved in ER-to-Golgi and Golgi-to-ER transport. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; trans-Golgi network : The network of interconnected tubular and cisternal structures located within the Golgi apparatus on the side distal to the endoplasmic reticulum, from which secretory vesicles emerge. The trans-Golgi network is important in the later stages of protein secretion where it is thought to play a key role in the sorting and targeting of secreted proteins to the correct destination. ; apical plasma membrane : The region of the plasma membrane located at the apical end of the cell. ; transport vesicle membrane : The lipid bilayer surrounding a transport vesicle. ; secretory granule membrane : The lipid bilayer surrounding a secretory granule. ; anchored component of external side of plasma membrane : The component of the plasma membrane consisting of the gene products that are tethered to the external side of the membrane only by a covalently attached anchor, such as a lipid group embedded in the membrane. Gene products with peptide sequences that are embedded in the membrane are excluded from this grouping. ; brush border membrane : The portion of the plasma membrane surrounding the brush border. ; anchored component of plasma membrane : The component of the plasma membrane consisting of the gene products that are tethered to the membrane only by a covalently attached anchor, such as a lipid group, that is embedded in the membrane. Gene products with peptide sequences that are embedded in the membrane are excluded from this grouping. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ;


Symbol
CA4
Name
carbonic anhydrase 4
Entrez ID
762
Ensembl ID
ENSG00000167434    (more details)
KEGG ID
hsa:762    (more details)
OMIM ID
114760
Uniprot ID
P22748  
GO ID
hsa:762    (more details)
Chromosome
X
Strand
1
Start
85861180
End
86047561
miRNA Interactions
hsa-miR-374a-5p (RPM: 52.6724) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Proximal tubule bicarbonate reclamation / Nitrogen metabolism /
Sequence
ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAGTCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTCAAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAGGCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACGTGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATTTCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGACTTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCACATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAAGACGAAATTGCGGTGCTGGCCTTTCTGGTGGAGGCTGGAACCCAGGTGAACGAGGGCTTCCAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGCACTACGATGGCAGAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCACTACTTCCGCTACCTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACTGTGTTCCGGGAGCCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTGTACTACGACAAGGAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTGGGGCAGCGCACGGTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCTGCCCTGCTGGGCCCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGA

Back to List