Details for gene: CLN3


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ; lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; endosome : A vacuole to which materials ingested by endocytosis are delivered. ; late endosome : A prelysosomal endocytic organelle differentiated from early endosomes by lower lumenal pH and different protein composition. Late endosomes are more spherical than early endosomes and are mostly juxtanuclear, being concentrated near the microtubule organizing center. ; caveola : A membrane raft that forms small pit, depression, or invagination that communicates with the outside of a cell and extends inward, indenting the cytoplasm and the cell membrane. Examples include flask-shaped invaginations of the plasma membrane in adipocytes associated with caveolin proteins, and minute pits or incuppings of the cell membrane formed during pinocytosis. Caveolae may be pinched off to form free vesicles within the cytoplasm. ; cytoplasmic vesicle : A vesicle found in the cytoplasm of a cell. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; membrane raft : Any of the small (10-200 nm), heterogeneous, highly dynamic, sterol- and sphingolipid-enriched membrane domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through protein-protein and protein-lipid interactions. ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; trans-Golgi network : The network of interconnected tubular and cisternal structures located within the Golgi apparatus on the side distal to the endoplasmic reticulum, from which secretory vesicles emerge. The trans-Golgi network is important in the later stages of protein secretion where it is thought to play a key role in the sorting and targeting of secreted proteins to the correct destination. ; synapse : The junction between an axon of one neuron and a dendrite of another neuron, a muscle fiber or a glial cell. As the axon approaches the synapse it enlarges into a specialized structure, the presynaptic terminal bouton, which contains mitochondria and synaptic vesicles. At the tip of the terminal bouton is the presynaptic membrane; facing it, and separated from it by a minute cleft (the synaptic cleft) is a specialized area of membrane on the receiving cell, known as the postsynaptic membrane. In response to the arrival of nerve impulses, the presynaptic terminal bouton secretes molecules of neurotransmitters into the synaptic cleft. These diffuse across the cleft and transmit the signal to the postsynaptic membrane. ; neuron projection : A prolongation or process extending from a nerve cell, e.g. an axon or dendrite. ; autophagosome : A double-membrane-bounded compartment that engulfs endogenous cellular material as well as invading microorganisms to target them to the lytic vacuole/lysosome for degradation as part of macroautophagy. ; late endosome membrane : The lipid bilayer surrounding a late endosome. ; early endosome : A membrane-bounded organelle that receives incoming material from primary endocytic vesicles that have been generated by clathrin-dependent and clathrin-independent endocytosis; vesicles fuse with the early endosome to deliver cargo for sorting into recycling or degradation pathways. ; recycling endosome : An organelle consisting of a network of tubules that functions in targeting molecules, such as receptors transporters and lipids, to the plasma membrane. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; early endosome membrane : The lipid bilayer surrounding an early endosome. ; synaptic vesicle : A secretory organelle, typically 50 nm in diameter, of presynaptic nerve terminals; accumulates in high concentrations of neurotransmitters and secretes these into the synaptic cleft by fusion with the 'active zone' of the presynaptic plasma membrane. ; Golgi stack : The set of thin, flattened membrane-bounded compartments, called cisternae, that form the central portion of the Golgi complex. The stack usually comprises cis, medial, and trans cisternae; the cis- and trans-Golgi networks are not considered part of the stack. ; integral component of endoplasmic reticulum membrane : The component of the endoplasmic reticulum membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; lysosome organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a lysosome. A lysosome is a cytoplasmic, membrane-bounded organelle that is found in most animal cells and that contains a variety of hydrolases. ; glycerophospholipid biosynthetic process : The chemical reactions and pathways resulting in the formation of glycerophospholipids, any derivative of glycerophosphate that contains at least one O-acyl, O-alkyl, or O-alkenyl group attached to the glycerol residue. ; membrane organization : A process which results in the assembly, arrangement of constituent parts, or disassembly of a membrane. A membrane is a double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins. ; regulation of protein processing : Any process that modulates the frequency, rate or extent of protein processing, any protein maturation process achieved by the cleavage of a peptide bond or bonds within a protein. ; regulation of cytoskeleton organization : Any process that modulates the frequency, rate or extent of the formation, arrangement of constituent parts, or disassembly of cytoskeletal structures. ; regulation of short-term neuronal synaptic plasticity : A process that modulates short-term neuronal synaptic plasticity, the ability of neuronal synapses to change in the short-term as circumstances require. Short-term neuronal synaptic plasticity generally involves increasing or decreasing synaptic sensitivity. ; protein processing : Any protein maturation process achieved by the cleavage of a peptide bond or bonds within a protein. Protein maturation is the process leading to the attainment of the full functional capacity of a protein. ; negative regulation of neuron apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process in neurons. ; regulation of cytosolic calcium ion concentration : Any process involved in the maintenance of an internal steady state of calcium ions within the cytosol of a cell or between the cytosol and its surroundings. ; Golgi to lysosome transport : The directed movement of substances from the Golgi to lysosomes. ; vesicle transport along microtubule : The directed movement of a vesicle along a microtubule, mediated by motor proteins. This process begins with the attachment of a vesicle to a microtubule, and ends when the vesicle reaches its final destination. ; amyloid precursor protein catabolic process : The chemical reactions and pathways resulting in the breakdown of amyloid precursor protein (APP), the precursor of amyloid-beta, a glycoprotein associated with Alzheimer's disease. ; sulfatide binding : Interacting selectively and non-covalently with sulfatide, also known as 3-O-sulfogalactosylceramide, SM4, or sulfated galactocerebroside. Sulfatide is a class of sulfoglycolipid, which are glycolipids that contain a sulfate group. ; neuromuscular process controlling balance : Any process that an organism uses to control its balance, the orientation of the organism (or the head of the organism) in relation to the source of gravity. In humans and animals, balance is perceived through visual cues, the labyrinth system of the inner ears and information from skin pressure receptors and muscle and joint receptors. ; negative regulation of catalytic activity : Any process that stops or reduces the activity of an enzyme. ; regulation of protein localization to plasma membrane : Any process that modulates the frequency, rate or extent of protein localization to plasma membrane. ; phagosome-lysosome fusion : The creation of a phagolysosome from a phagosome and a lysosome. ; ionotropic glutamate receptor signaling pathway : A series of molecular signals initiated by glutamate binding to a glutamate receptor on the surface of the target cell, followed by the movement of ions through a channel in the receptor complex. Ends with regulation of a downstream cellular process, e.g. transcription. ; receptor-mediated endocytosis : An endocytosis process in which cell surface receptors ensure specificity of transport. A specific receptor on the cell surface binds tightly to the extracellular macromolecule (the ligand) that it recognizes; the plasma-membrane region containing the receptor-ligand complex then undergoes endocytosis, forming a transport vesicle containing the receptor-ligand complex and excluding most other plasma-membrane proteins. Receptor-mediated endocytosis generally occurs via clathrin-coated pits and vesicles. ; lysosomal lumen acidification : Any process that reduces the pH of the lysosomal lumen, measured by the concentration of the hydrogen ion. ; regulation of synaptic transmission, GABAergic : Any process that modulates the frequency, rate or extent of GABAergic synaptic transmission, the process of communication from a neuron to another neuron across a synapse using the neurotransmitter gamma-aminobutyric acid (GABA). ; positive regulation of Golgi to plasma membrane protein transport : Any process that activates or increases the frequency, rate or extent of the transport of proteins from the Golgi to the plasma membrane. ; autophagosome maturation : Removal of PI3P and Atg8/LC3 after the closure of the phagophore and before the fusion with the endosome/lysosome (e.g. mammals and insects) or vacuole (yeast), and that very likely destabilizes other Atg proteins and thus enables their efficient dissociation and recycling. ; learning or memory : The acquisition and processing of information and/or the storage and retrieval of this information over time. ; regulation of intracellular pH : Any process that modulates the internal pH of a cell, measured by the concentration of the hydrogen ion. ; negative regulation of proteolysis : Any process that stops, prevents, or reduces the frequency, rate or extent of the hydrolysis of a peptide bond or bonds within a protein. ; cellular water homeostasis : Any process involved in the maintenance of an internal steady state of water within a cell. ; lysosomal protein catabolic process : Any cellular protein catabolic process that takes place in a lysosome. ; vacuole : A closed structure, found only in eukaryotic cells, that is completely surrounded by unit membrane and contains liquid material. Cells contain one or several vacuoles, that may have different functions from each other. Vacuoles have a diverse array of functions. They can act as a storage organelle for nutrients or waste products, as a degradative compartment, as a cost-effective way of increasing cell size, and as a homeostatic regulator controlling both turgor pressure and pH of the cytosol. ; associative learning : Learning by associating a stimulus (the cause) with a particular outcome (the effect). ; glycolipid binding : Interacting selectively and non-covalently with a glycolipid, any compound containing one or more monosaccharide residues bound by a glycosidic linkage to a hydrophobic group such as an acylglycerol, a sphingoid, a ceramide (N-acylsphingoid) or a prenyl phosphate. ; regulation of synaptic transmission, glutamatergic : Any process that modulates the frequency, rate or extent of glutamatergic synaptic transmission, the process of communication from a neuron to another neuron across a synapse using the neurotransmitter glutamate. ; action potential : A process in which membrane potential cycles through a depolarizing spike, triggered in response to depolarization above some threshold, followed by repolarization. This cycle is driven by the flow of ions through various voltage gated channels with different thresholds and ion specificities. ; autophagosome-lysosome fusion : The process in which autophagosomes, double-membraned vesicles containing cytoplasmic material, fuse with a vacuole (yeast) or lysosome (e.g. mammals and insects). In the case of yeast, inner membrane-bounded structures (autophagic bodies) appear in the vacuole. Fusion provides an acidic environment and digestive function to the interior of the autophagosome. ; positive regulation of pinocytosis : Any process that activates, maintains or increases the rate of pinocytosis. Pinocytosis is the process in which cells take in liquid material from their external environment; literally 'cell drinking'. Liquid is enclosed in vesicles, formed by invagination of the plasma membrane. These vesicles then move into the cell and pass their contents to endosomes. ; regulation of fibroblast migration : Any process that modulates the rate, frequency or extent of fibroblast cell migration. Fibroblast cell migration is accomplished by extension and retraction of a pseudopodium. ; arginine transport : The directed movement of arginine, 2-amino-5-guanidinopentanoic acid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; lysosomal lumen pH elevation : Any process that increases the pH of the lysosomal lumen, measured by the concentration of the hydrogen ion. ; renal potassium excretion : The elimination by an organism of potassium in the urine. ; neurotransmitter metabolic process : The chemical reactions and pathways involving neurotransmitters, any of a group of substances that are released on excitation from the axon terminal of a presynaptic neuron of the central or peripheral nervous system and travel across the synaptic cleft to either excite or inhibit the target cell. ; plasma membrane raft organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of plasma membrane rafts. ; glycolipid transport : The directed movement of glycolipids, compounds containing (usually) 1-4 linked monosaccharide residues joined by a glycosyl linkage to a lipid, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; phagosome-lysosome docking : The initial attachment of a phagosome membrane to a lysosome membrane. Docking requires only that the proteins come close enough to interact and adhere. ; regulation of cellular response to osmotic stress : Any process that modulates the frequency, rate or extent of the cellular response to osmotic stress. ; regulation of arginine biosynthetic process : Any process that modulates the frequency, rate or extent of arginine biosynthetic process. ; regulation of autophagosome maturation : Any process that modulates the frequency, rate or extent of autophagosome maturation. ; regulation of phagosome maturation : Any process that modulates the frequency, rate or extent of phagosome maturation. ; regulation of modification of synaptic structure : Any process that modulates the frequency, rate or extent of modification of synaptic structure. ; positive regulation of caveolin-mediated endocytosis : Any process that activates or increases the frequency, rate or extent of caveolin-mediated endocytosis. ; autolysosome : A type of secondary lysosome in which a primary lysosome has fused with the outer membrane of an autophagosome. It is involved in the second step of autophagy in which it degrades contents with acidic lysosomal hydrolases. ; calcium-dependent protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules), in the presence of calcium. ; positive regulation of protein phosphorylation : Any process that activates or increases the frequency, rate or extent of addition of phosphate groups to amino acids within a protein. ; amino acid transport : The directed movement of amino acids, organic acids containing one or more amino substituents, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; endocytosis : A vesicle-mediated transport process in which cells take up external materials or membrane constituents by the invagination of a small region of the plasma membrane to form a new membrane-bounded vesicle. ; regulation of autophagy : Any process that modulates the frequency, rate or extent of autophagy. Autophagy is the process in which cells digest parts of their own cytoplasm. ; macroautophagy : The major inducible pathway for the general turnover of cytoplasmic constituents in eukaryotic cells, it is also responsible for the degradation of active cytoplasmic enzymes and organelles during nutrient starvation. Macroautophagy involves the formation of double-membrane-bounded autophagosomes which enclose the cytoplasmic constituent targeted for degradation in a membrane-bounded structure. Autophagosomes then fuse with a lysosome (or vacuole) releasing single-membrane-bounded autophagic bodies that are then degraded within the lysosome (or vacuole). Some types of macroautophagy, e.g. pexophagy, mitophagy, involve selective targeting of the targets to be degraded. ; regulation of autophagosome size : Any process that modulates the size of the autophagosome. ; cell migration : The controlled self-propelled movement of a cell from one site to a destination guided by molecular cues. Cell migration is a central process in the development and maintenance of multicellular organisms. ; actin cytoskeleton organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures comprising actin filaments and their associated proteins. ; regulation of filopodium assembly : Any process that modulates the frequency, rate or extent of the assembly of a filopodium, a thin, stiff protrusion extended by the leading edge of a motile cell such as a crawling fibroblast or amoeba, or an axonal growth cone. ; protein localization to membrane : A process in which a protein is transported to, or maintained in, a specific location in a membrane. ; protein localization to plasma membrane : A process in which a protein is transported to, or maintained in, a specific location in the plasma membrane. ; : ;


Symbol
CLN3
Name
CLN3 lysosomal/endosomal transmembrane protein, battenin
Entrez ID
1201
Ensembl ID
ENSG00000188603    (more details)
KEGG ID
hsa:1201    (more details)
OMIM ID
204200
Uniprot ID
A0A024QZB8  
GO ID
hsa:1201    (more details)
Chromosome
4
Strand
-1
Start
47935977
End
48016681
miRNA Interactions
hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-3619-5p (RPM: 0.0804) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-29b-1-5p (RPM: 1.1774) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-29b-2-5p (RPM: 5.083) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Lysosome /
Sequence
ATGGGAGGCTGTGCAGGCTCGCGGCGGCGCTTTTCGGATTCCGAGGGGGAGGAGACCGTCCCGGAGCCCCGGCTCCCTCTGTTGGACCATCAGGGCGCGCATTGGAAGAACGCGGTGGGCTTCTGGCTGCTGGGCCTTTGCAACAACTTCTCTTATGTGGTGATGCTGAGTGCCGCCCACGACATCCTTAGCCACAAGAGGACATCGGGAAACCAGAGCCATGTGGACCCAGGCCCAACGCCGATCCCCCACAACAGCTCATCACGATTTGACTGCAACTCTGTCTCTACGGCTGCTGTGCTCCTGGCGGACATCCTCCCCACACTCGTCATCAAATTGTTGGCTCCTCTTGGCCTTCACCTGCTGCCCTACAGCCCCCGGGTTCTCGTCAGTGGGATTTGTGCTGCTGGAAGCTTCGTCCTGGTTGCCTTTTCTCATTCTGTGGGGACCAGCCTGTGTGGTGTGGTCTTCGCTAGCATCTCATCAGGCCTTGGGGAGGTCACCTTCCTCTCCCTCACTGCCTTCTACCCCAGGGCCGTGATCTCCTGGTGGTCCTCAGGGACTGGGGGAGCTGGGCTGCTGGGGGCCCTGTCCTACCTGGGCCTCACCCAGGCCGGCCTCTCCCCTCAGCAGACCCTGCTGTCCATGCTGGGTATCCCTGCCCTGCTGCTGGCCAGCTATTTCTTGTTGCTCACATCTCCTGAGGCCCAGGACCCTGGAGGGGAAGAAGAAGCAGAGAGCGCAGCCCGGCAGCCCCTCATAAGAACCGAGGCCCCGGAGTCGAAGCCAGGCTCCAGCTCCAGCCTCTCCCTTCGGGAAAGGTGGACAGTGTTCAAGGGTCTGCTGTGGTACATTGTTCCCTTGGTCGTAGTTTACTTTGCCGAGTATTTCATTAACCAGGGACTTTTTGAACTCCTCTTTTTCTGGAACACTTCCCTGAGTCACGCTCAGCAATACCGCTGGTACCAGATGCTGTACCAGGCTGGCGTCTTTGCCTCCCGCTCTTCTCTCCGCTGCTGTCGCATCCGTTTCACCTGGGCCCTGGCCCTGCTGCAGTGCCTCAACCTGGTGTTCCTGCTGGCAGACGTGTGGTTCGGCTTTCTGCCAAGCATCTACCTCGTCTTCCTGATCATTCTGTATGAGGGGCTCCTGGGAGGCGCAGCCTACGTGAACACCTTCCACAACATCGCCCTGGAGACCAGTGATGAGCACCGGGAGTTTGCAATGGCGGCCACCTGCATCTCTGACACACTGGGGATCTCCCTGTCGGGGCTCCTGGCTTTGCCTCTGCATGACTTCCTCTGCCAGCTCTCCTGA

Back to List