Details for gene: CNGA1


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; ion channel activity : Enables the facilitated diffusion of an ion (by an energy-independent process) by passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. May be either selective (it enables passage of a specific ion only) or non-selective (it enables passage of two or more ions of same charge but different size). ; cation transmembrane transport : The process in which a cation is transported across a membrane. ; intracellular cyclic nucleotide activated cation channel activity : Enables the transmembrane transfer of a cation by a channel that opens when intracellular cyclic nucleotide has been bound by the channel complex or one of its constituent parts. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; cGMP binding : Interacting selectively and non-covalently with cGMP, the nucleotide cyclic GMP (guanosine 3',5'-cyclophosphate). ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; intracellular cAMP-activated cation channel activity : Enables the transmembrane transfer of a cation by a channel that opens when intracellular cAMP has been bound by the channel complex or one of its constituent parts. ; intracellular cGMP-activated cation channel activity : Enables the transmembrane transfer of a cation by a channel that opens when intracellular cGMP has been bound by the channel complex or one of its constituent parts. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ;


Symbol
CNGA1
Name
cyclic nucleotide gated channel subunit alpha 1
Entrez ID
1259
Ensembl ID
ENSG00000198515    (more details)
KEGG ID
hsa:1259    (more details)
OMIM ID
123825
Uniprot ID
A0A024R9X3  
GO ID
hsa:1259    (more details)
Chromosome
19
Strand
-1
Start
47819779
End
47843330
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-7-5p (RPM: 19.3682) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
cGMP-PKG signaling pathway / cAMP signaling pathway / Phototransduction /
Sequence
ATGAAGAACAATATTATCAATACACAGCAGTCTTTTGTAACCATGCCCAATGTGATTGTACCAGATATTGAAAAGGAAATACGAAGGATGGAAAATGGAGCATGCAGCTCCTTTTCTGAGGATGATGACAGTGCCTCTACATCTGAAGAATCAGAGAATGAAAACCCTCATGCAAGGGGTTCCTTTAGTTATAAGTCACTCAGAAAGGGAGGACCATCACAGAGGGAGCAGTACCTGCCTGGTGCCATTGCACTTTTTAATGTGAACAACAGCAGCAATAAGGACCAGGAACCAGAAGAAAAAAAGAAAAAGAAAAAAGAAAAGAAGAGCAAGTCAGATGATAAAAACGAAAATAAAAACGACCCAGAGAAGAAAAAGAAGAAAAAGGACAAAGAGAAGAAAAAGAAAGAGGAGAAAAGCAAAGATAAGAAAGAAGAGGAGAAGAAAGAAGTTGTGGTTATTGATCCCTCGGGAAACACATATTACAACTGGCTGTTTTGCATCACATTACCTGTTATGTACAACTGGACAATGGTTATTGCCAGAGCATGTTTTGATGAACTTCAATCTGATTACCTAGAATATTGGCTCATTTTGGATTACGTATCAGACATAGTCTATTTAATCGATATGTTTGTACGAACAAGGACAGGTTACCTAGAACAAGGACTGCTGGTAAAGGAAGAACTTAAACTCATAAATAAATATAAATCCAACTTGCAATTTAAACTTGATGTTCTGTCACTGATACCAACTGATTTGCTGTATTTTAAGTTAGGGTGGAACTATCCAGAAATTAGATTAAACAGGTTGTTACGGTTCTCTCGTATGTTTGAGTTCTTCCAGAGAACAGAAACAAGGACAAACTATCCAAACATCTTCAGGATTTCCAACCTTGTTATGTATATCGTCATCATTATCCACTGGAATGCATGTGTGTTCTACTCTATTTCTAAAGCTATTGGATTTGGAAATGATACATGGGTCTACCCTGATATTAATGATCCTGAATTTGGCCGTTTGGCTAGAAAATACGTATACAGCCTTTACTGGTCTACACTGACTTTGACTACCATTGGTGAAACACCCCCTCCCGTGAGGGATTCTGAGTATGTCTTTGTGGTGGTTGATTTCCTAATTGGAGTGTTAATTTTTGCTACCATCGTTGGTAACATAGGTTCTATGATTTCCAACATGAATGCAGCCAGAGCAGAATTTCAAGCAAGAATTGATGCTATCAAGCAATATATGCATTTTCGAAATGTAAGCAAAGATATGGAAAAGAGGGTTATTAAATGGTTTGACTACCTGTGGACCAACAAAAAAACAGTTGATGAGAAAGAAGTCTTAAAGTATCTACCTGATAAACTAAGAGCAGAAATTGCCATCAACGTTCACTTAGACACATTAAAAAAGGTACGCATTTTTGCTGATTGTGAAGCTGGTCTGTTGGTGGAGTTGGTCTTGAAATTGCAACCCCAAGTCTACAGTCCTGGAGATTATATTTGCAAGAAAGGGGATATCGGACGAGAGATGTACATTATCAAGGAAGGCAAACTCGCTGTGGTGGCAGATGATGGAGTCACTCAGTTTGTGGTATTGAGCGATGGCAGCTACTTCGGTGAGATCAGCATTCTTAACATTAAAGGGAGCAAAGCTGGCAATCGAAGAACGGCCAATATTAAAAGTATTGGCTACTCAGACCTGTTCTGTCTCTCAAAAGATGACCTCATGGAAGCTCTAACTGAGTACCCAGATGCCAAAACTATGCTGGAAGAGAAAGGGAAGCAGATTTTAATGAAAGATGGTCTACTGGATCTAAACATTGCAAATGCTGGCAGTGATCCTAAAGATCTTGAAGAGAAGGTTACTCGAATGGAGGGGTCAGTAGACCTCCTGCAAACCAGGTTTGCCCGAATCTTGGCTGAGTATGAGTCCATGCAGCAGAAACTGAAACAAAGATTAACCAAGGTTGAGAAATTTCTGAAACCGCTTATTGACACAGAATTTTCAAGTATTGAGGGACCTGGAGCGGAAAGTGGGCCCATCGACTCTACATAG

Back to List